Systematic analysis of cis-elements in unstable mRNAs demonstrates that CUGBP1 is a key regulator of mRNA decay in muscle cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE21236 | GEO | 2010/06/21
SECONDARY ACCESSION(S): PRJNA126505
REPOSITORIES: GEO
Similar Datasets
Project description:Dramatic changes in gene expression occur in response to extracellular stimuli and during differentiation. Although transcriptional effects are important, alterations in mRNA decay also play a major role in achieving rapid and massive changes in mRNA abundance. Moreover, just as transcription factor activity varies between different cell types, the factors influencing mRNA decay are also cell-type specific.We have established the rates of decay for over 7000 transcripts expressed in mouse C2C12 myoblasts. We found that GU-rich (GRE) and AU-rich (ARE) elements are over-represented in the 3'UTRs of short-lived mRNAs and that these mRNAs tend to encode factors involved in cell cycle and transcription regulation. Stabilizing elements were also identified. By comparing mRNA decay rates in C2C12 cells with those previously measured for pluripotent and differentiating embryonic stem (ES) cells, we identified several groups of transcripts that exhibit cell-type specific decay rates. Further, whereas in C2C12 cells the impact of GREs on mRNA decay appears to be greater than that of AREs, AREs are more significant in ES cells, supporting the idea that cis elements make a cell-specific contribution to mRNA stability. GREs are recognized by CUGBP1, an RNA-binding protein and instability factor whose function is affected in several neuromuscular diseases. We therefore utilized RNA immunoprecipitation followed by microarray (RIP-Chip) to identify CUGBP1-associated transcripts. These mRNAs also showed dramatic enrichment of GREs in their 3'UTRs and encode proteins linked with cell cycle, and intracellular transport. Interestingly several CUGBP1 substrate mRNAs, including those encoding the myogenic transcription factors Myod1 and Myog, are also bound by the stabilizing factor HuR in C2C12 cells. Finally, we show that several CUGBP1-associated mRNAs containing 3'UTR GREs, including Myod1, are stabilized in cells depleted of CUGBP1, consistent with the role of CUGBP1 as a destabilizing factor.Taken together, our results systematically establish cis-acting determinants of mRNA decay rates in C2C12 myoblast cells and demonstrate that CUGBP1 associates with GREs to regulate decay of a wide range of mRNAs including several that are critical for muscle development.
| S-EPMC2888570 | biostudies-literature
Project description:This SuperSeries is composed of the following subset Series: GSE21233: Expression data from C2C12 mouse myoblast with treatment actinomycin D GSE21235: mRNA immunoprecipitated with CUGBP1 in C2C12 Refer to individual Series
2010-07-08 | E-GEOD-21236 | biostudies-arrayexpress
Project description:Gene expression is regulated at each step from chromatin remodeling through translation and degradation. Several known RNA-binding regulatory proteins interact with specific RNA secondary structures in addition to specific nucleotides. To provide a more comprehensive understanding of the regulation of gene expression, we developed an integrative computational approach that leverages functional genomics data and nucleotide sequences to discover RNA secondary structure-defined cis-regulatory elements (SCREs). We applied our structural cis-regulatory element detector (StructRED) to microarray and mRNA sequence data from Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We recovered the known specificities of Vts1p in yeast and Smaug in flies. In addition, we discovered six putative SCREs in flies and three in humans. We characterized the SCREs based on their condition-specific regulatory influences, the annotation of the transcripts that contain them, and their locations within transcripts. Overall, we show that modeling functional genomics data in terms of combined RNA structure and sequence motifs is an effective method for discovering the specificities and regulatory roles of RNA-binding proteins.
| S-EPMC2683727 | biostudies-literature
Project description:CUGBP1 and MBNL1 are developmentally regulated RNA-binding proteins that are causally associated with myotonic dystrophy type 1. We globally determined the in vivo RNA-binding sites of CUGBP1 and MBNL1. Interestingly, CUGBP1 and MBNL1 are both preferentially bound to 39 UTRs. Analysis of CUGBP1- and MBNL1-bound 39 UTRs demonstrated that both factors mediate accelerated mRNA decay and temporal profiles of expression arrays supported this. Role of CUGBP1 on accelerated mRNA decay has been previously reported, but the similar function of MBNL1 has not been reported to date. It is well established that CUGBP1 and MBNL1 regulate alternative splicing. Screening by exon array and validation by RT-PCR revealed position dependence of CUGBP1- and MBNL1-binding sites on the resulting alternative splicing pattern. This study suggests that regulation of CUGBP1 and MBNL1 is essential for accurate control of destabilization of a broad spectrum of mRNAs as well as of alternative splicing events.
| S-EPMC3250574 | biostudies-literature
Project description:Factor XII (FXII) deficiency is a recessive Mendelian trait due to mutations in the F12 gene. There is no bleeding associated with FXII deficiency, but FXII deficiency has been reported to be associated with risk of thrombosis in some studies.We examined the functional effect of two naturally-occurring mutations in two Spanish FXII deficient families: a C/G substitution at position -8, and a C/T substitution at position -13. Both mutations were located on a putative HNF4 binding site of F12 gene promoter. We also analyzed the F12 C46T polymorphism (rs1801020), associated with a decrease in the FXII levels, which also segregated in both families. A fragment containing each one of both -8 and -13 mutations, was cloned 5' of a reporter gene. We compared the in vitro expression of these constructs to the wild type expression.Our analyses confirm that the -8C/G and the -13C/T mutations decreased expression levels, demonstrating that both mutations are involved in the observed FXII deficiency. In addition, electrophoretic shift analyses suggest that they alter the union of nuclear proteins to the promoter. Coinheritance of these mutations with the C46T polymorphism, result in a significant genotype-phenotype correlation.We have identified two naturally-occurring mutations in the F12 promoter that drastically reduce FXII levels. Knowing rare genetic alterations in the F12 gene, together with the C46T common variant, may yield further understanding about the genetic architecture of FXII levels, which may have a role in the risk of thrombosis.
| S-EPMC2906145 | biostudies-literature
Project description:CUG-repeat binding protein 1 (CUGBP1) mediates selective mRNA decay by binding to GU-rich elements (GREs) containing the sequence UGUUUGUUUGU found in the 3' untranslated region (UTR) of short-lived transcripts. We used an anti-CUGBP1 antibody to immunoprecipitate CUGBP1 from HeLa cytoplasmic extracts and analyzed the associated transcripts using oligonucleotide microarrays. We identified 613 putative mRNA targets of CUGBP1 and found that the UGUUUGUUUGU GRE sequence and a GU-repeat sequence were both highly enriched in the 3' UTRs of these targets. We showed that CUGBP1 bound specifically to the GU-repeat sequence and that insertion of this sequence into the 3' UTR of a beta-globin reporter transcript conferred instability to the transcript. Based on these results, we redefined the GRE to include this GU-repeat sequence. Our results suggest that CUGBP1 coordinately regulates the mRNA decay of a network of transcripts involved in cell growth, cell motility, and apoptosis.
| S-EPMC2916446 | biostudies-literature
Project description:In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.
| S-EPMC2936534 | biostudies-literature
Project description:Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.
| S-EPMC1186718 | biostudies-literature
Project description:Specification and development of Drosophila germ cells depend on molecular determinants within the germ plasm, a specialized cytoplasmic domain at the posterior of the embryo. Localization of numerous mRNAs to the germ plasm occurs by their incorporation, as single-transcript ribonucleoprotein (RNP) particles, into complex RNP granules called polar granules. Incorporation of mRNAs into polar granules is followed by recruitment of additional like transcripts to form discrete homotypic clusters. The cis-acting localization signals that target mRNAs to polar granules and promote homotypic clustering remain largely uncharacterized. Here, we show that the polar granule component (pgc) and germ cell-less (gcl) 3' untranslated regions contain complex localization signals comprising multiple, independently weak and partially functionally redundant localization elements (LEs). We demonstrate that targeting of pgc to polar granules and self-assembly into homotypic clusters are functionally separable processes mediated by distinct classes of LEs. We identify a sequence motif shared by other polar granule mRNAs that contributes to homotypic clustering. Our results suggest that mRNA localization signal complexity may be a feature required by the targeting and self-recruitment mechanism that drives germ plasm mRNA localization.
| S-EPMC6262787 | biostudies-literature
Project description:BackgroundMuch of the organismal variation we observe in nature is due to differences in organ size. The observation that even closely related species can show large, stably inherited differences in organ size indicates a strong genetic component to the control of organ size. Despite recent progress in identifying factors controlling organ growth in plants, our overall understanding of this process remains limited, partly because the individual factors have not yet been connected into larger regulatory pathways or networks. To begin addressing this aim, we have studied the upstream regulation of expression of BIG BROTHER (BB), a central growth-control gene in Arabidopsis thaliana that prevents overgrowth of organs. Final organ size and BB expression levels are tightly correlated, implying the need for precise control of its expression. BB expression mirrors proliferative activity, yet the gene functions to limit proliferation, suggesting that it acts in an incoherent feedforward loop downstream of growth activators to prevent over-proliferation.ResultsTo investigate the upstream regulation of BB we combined a promoter deletion analysis with a phylogenetic footprinting approach. We were able to narrow down important, highly conserved, cis-regulatory elements within the BB promoter. Promoter sequences of other Brassicaceae species were able to partially complement the A. thaliana bb-1 mutant, suggesting that at least within the Brassicaceae family the regulatory pathways are conserved.ConclusionsThis work underlines the complexity involved in precise quantitative control of gene expression and lays the foundation for identifying important upstream regulators that determine BB expression levels and thus final organ size.
| S-EPMC3362746 | biostudies-literature