Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Fecal microbiota in mice before and after repeated mild stress

ABSTRACT: To examine potential changes of the intestinal microbiota in mice caused by repeated mild stress, we profiled bacteria and fungi in the mouse feces by sequencing the 16s v3v4 region and the ITS1-2 region.

ORGANISM(S): feces metagenome

PROVIDER: GSE222533 | GEO | 2024/09/23

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Fecal microbiota in mice before and after repeated mild stress

Project description:Fecal microbiota in mice before and after repeated mild stress

| PRJNA922482 | ENA

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

Impact of fecal microbiota transplantation (FMT) in 3 days-ABX-treated recipient mice using feces from 6 NSCLC patients at diagnosis.

Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.

2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress

Correlation analysis between gut microbiota characteristics and melasma

Project description:To compare the similarities and differences in species diversity of the gut microbiota between the patients with melasma and healthy subjects. The feces were collected for 16S rRNA sequencing analysis of the gut microbiota.

2022-10-25 | GSE214430 | GEO

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

Fecal metatranscriptomics from healthy adults before and after supplementation with bovine milk oligosaccharides

Project description:Complex oligosaccharides found in human milk play a vital role in gut microbiome development for the human infant. Bovine milk oligosaccharides (BMO) have similar structures with those derived from human milk, but have not been well studied for their effects on the healthy adult human gut microbiome. Healthy human subjects consumed BMO over two-week periods at two different doses and provided fecal samples. Metatranscriptomics of fecal samples was conducted to determine microbial and host gene expression in response to the supplement. Fecal samples were also analyzed by mass spectrometry to determine levels of undigested BMO. No changes were observed in microbiome activity across all participants. Repeated sampling enabled subject-specific analyses: four of six participants had minor, yet statistically significant, changes in microbial activity. No significant change was observed in the gene expression of host cells in stool. Levels of BMO excreted in feces after supplementation were not significantly different from placebo and were not correlated with dosage or expressed microbial enzyme levels. Collectively, these data suggest that BMO is fully digested in the human gastrointestinal tract prior to stool collection. Participants’ gut microbiomes remained stable but varied between individuals. Additionally, the unaltered host transcriptome provides further evidence for the safety of BMO as a dietary supplement or food ingredient.

2020-02-18 | GSE108809 | GEO

ena-DATASET-UMCG-30-01-2018-15:43:28:290-245 - samples

Project description:Sequencing of V4 hypervariable region of 16S gene of microbiota present in feces of IBD patients

| EGAD00001003935 | EGA

Human gut microbiota, COVID-19 patients with mild or severe symptoms.

Project description:Analysis of COVID-19 hospitalized patients, with different kind of symptoms, by human rectal swabs collection and 16S sequencing approach.

2022-09-22 | E-MTAB-12236 | biostudies-arrayexpress

Gut microbiota analysis in WT and Il17d-deficient mice treated with or without colitis

Project description:Microbiota dysbiosis has been reported to contribute to the pathogenesis of colitis, to demonstrate whether IL-17D protects against DSS-induced colitis through regulation of microflora, we performed 16S rRNA sequencing in feces from WT and Il17d-deficient mice. Our data indicate that Il17d deficiency results in microbiota dysibiosis in both steady state and DSS-induced colitis.

2021-05-20 | GSE165789 | GEO

Gut microbiota drives vitiligo-related oxidative stress in skin via the metabolite Hippuric Acid

Project description:Vitiligo is a common autoimmune skin disorder. We constructed an induced vitiligo mouse model and performed bulk-RNA sequencing on the skin and 16S rRNA sequencing of feces from vitiligo mice and uninduced mice. Next, we performed skin bulk-RNA sequencing after treatment using ABX. Lastly, we subjected gut microbe-related metabolite hippuric acid to control mice and performed bulk-RNA sequencing on the skin to observe oxidative stress-related gene expression changes.

2024-08-21 | GSE273242 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data