Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

EWS siRNA knock-down in HeLa cell line

ABSTRACT: HeLa cell line was trasfected by a EWS siRNA oligo causing knock-down of EWS or a siRNA scrambled oligo

ORGANISM(S): Homo sapiens

PROVIDER: GSE22929 | GEO | 2011/09/20

SECONDARY ACCESSION(S): PRJNA127931

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

EWS siRNA knock-down in HeLa cell line

Project description:HeLa cell line was trasfected by a EWS siRNA oligo causing knock-down of EWS or a siRNA scrambled oligo Three biological replicates were labeled in direct and dye-swap microarray experiments and hybridized onto an Agilent custom splicing-sensitive microarray platform.

2011-09-19 | E-GEOD-22929 | biostudies-arrayexpress

SF3b155 knock-down by two different siRNA oligos in HeLa cells

Project description:Analysis of the alternative pre-mRNA procesing after SF3b155 siRNA knock-down in HeLa cells employing a custom microarray platform sensitive to splicing. HeLa cells were transfected with either a scrambled RNA or one of the two different SF3b155 siRNA oligonucleotides (oligo 3: 5’-GACAGCAGAUUUGCUGGAUACGUGA-3; oligo 5: 5’-CCCUGUGGCAUUGCUUAAUGAUAU-3’). Total RNA samples from three biological replicates were labeled in direct and dye-swap hybridizations. Labeled samples were hybridized into our custom splicing-sensitive agilent platform which contains 1804 splicing events from 482 genes.

2011-03-08 | E-GEOD-22952 | biostudies-arrayexpress

SF3b155 knock-down by two different siRNA oligos in HeLa cells

Project description:Analysis of the alternative pre-mRNA procesing after SF3b155 siRNA knock-down in HeLa cells employing a custom microarray platform sensitive to splicing.

2011-03-08 | GSE22952 | GEO

Expression data from HeLa cells after MBD2 and MBD3 knock down

Project description:The heterogeneous collection of NuRD complexes can be grouped into the MBD2 or MBD3 containing complexes MBD2-NuRD and MBD3-NuRD. MBD2 is known to bind to methylated CpG sequences in vitro in contrast to MBD3. Although functional differences have been described, a direct comparison of MBD2 and MBD3 in respect to genome-wide binding and function has been lacking. Here we show when depleting cells for MBD2, the MBD2 bound genes increase their activity, whereas MBD2 plus MBD3 bound genes reduce their activity. Most strikingly, MBD3 is enriched at active promoters, whereas MBD2 is bound at methylated promoters and enriched at exon sequences of active genes. This suggests a functional connection between MBD2 binding to chromatin and splicing. 9 Total samples were analysed. Three individual replicates for HeLa cells treated with siRNA against MBD2, MBD3 or scrambled siRNA were performed. We calculated the fold change of gene expression of cells treated with MBD2- or MBD3-siRNA over cells treated with scrambled siRNA.

2013-02-08 | E-GEOD-41003 | biostudies-arrayexpress

siRNA profiling of human GBS6 cells after EWS-POU5F1 knockdown II

Project description:GBS6 cells were established from an undifferentiated bone sarcoma carrying translocation t(6;22)(p21;q12). The translocation resulted in a gene fusion between EWS and POU5F1. Gene expression analysis of t(6;22) undifferentiated sarcoma cell line GBS6 transfected with POU5F1 specific siRNA to investigate the function of EWS-POU5F1. Experiment Overall Design: 6 samples are analyzed. Two control samples and Four reference samples were analyzed.

2009-11-15 | E-GEOD-18901 | biostudies-arrayexpress

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

ENO1 siRNA knockdown in Human HeLa cells

Project description:ENO1 siRNA knockdown in Human HeLa cells

| PRJEB38053 | ENA

Hela SPAG4 siRNA

Project description:In order to clarify the downstream target genes of SPAG4, we performed knockdown of SPAG4 using siRNA both under normoxia and hypoxia. Hela cells are cultured for 24 hours under normoxia and hypoxia after knocking down of SPAG4 using different sequences of siRNA.

2013-04-16 | E-GEOD-46054 | biostudies-arrayexpress

Probing off-target effect of LMNA siRNA and pro-siRNA in HeLa-d1EGFP cell line

Project description:We have develped a novel method of making siRNAs (named pro-siRNA for prokaryotic siRNA). To evaluate off-targeting of pro-siRNA, we compared mRNA expression profile of HeLa-d1EGFP cells transfected with 4 nM LMNA siRNAs and pro-siRNAs by microarray.

2013-02-06 | GSE44105 | GEO

siRNA profiling of human HEK and HeLa cell lines

Project description:HEK siRNA vs. HEK control<br>HeLA siRNA vs. HeLa control

2010-02-25 | E-MEXP-2591 | biostudies-arrayexpress