Dataset Information

Systematic interrogation of CRISPR-based antimicrobials in Klebsiella pneumoniae reveals nuclease-, guide-, and strain-specific factors influencing antimicrobial activity

ABSTRACT: CRISPR-Cas systems can be utilized as programmable-spectrum antimicrobials to combat bacterial infections. However, how CRISPR nucleases perform as antimicrobials across target sites and strains remains poorly explored. Here, we address this knowledge gap by systematically interrogating the use of CRISPR antimicrobials against multidrug-resistant and hypervirulent strains of Klebsiella pneumoniae. Comparing different Cas nucleases, we found that AsCas12a exhibited robust targeting across different strains. The elucidated modes of escape from this nuclease varied widely, restraining opportunities to enhance killing. We also encountered individual guide RNAs yielding different extents of clearance across strains. The differences were attributed to improper RNA folding, leading to inefficient DNA cleavage and subsequent repair via homologous recombination. To explore features that could improve targeting across strains, we performed a genome-wide screen in different K. pneumoniae strains that yielded guide design rules and trained an algorithm for predicting guide efficiency. Finally, we showed that Cas12a antimicrobials can be exploited to eliminate K. pneumoniae when encoded in phagemids delivered by T7-like phages. Altogether, our results highlight the importance of evaluating antimicrobial activity of CRISPR antimicrobials across relevant strains and define critical parameters for efficient CRISPR-based targeting.

ORGANISM(S): Escherichia coli Klebsiella pneumoniae

PROVIDER: GSE237136 | GEO | 2023/07/17

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:CRISPR-Cas immune systems function to defend prokaryotes against potentially harmful mobile genetic elements including viruses and plasmids. The multiple CRISPR-Cas systems (Types I, II, III) each recognize and target destruction of foreign invader nucleic acids via structurally and functionally diverse effector complexes (crRNPs). CRISPR-Cas effector complexes are comprised of CRISPR RNAs (crRNAs) that contain sequences homologous to the invading nucleic acids and Cas proteins specific to each immune system type. We have previously characterized a crRNP in Pyrococcus furiosus (Pfu) that contains Cmr proteins (Type III-B) associated with one of two primary size forms of crRNAs and functions through homology-dependent cleavage of target RNAs. In the current study, we have isolated and characterized two additional native Pfu CRISPR-Cas complexes containing either Csa (Type I-A) or Cst (Type I-G) proteins and distinct profiles of associated crRNAs. For each complex, the Cas proteins were identified by tandem mass spectrometry and immunoblotting and the crRNAs by RNA deep sequencing and Northern blot analysis. The crRNAs associated with both the Csa and Cst complexes originate from each of seven total CRISPR loci and contain identical 5’ ends (8-nt CRISPR RNA repeat-derived 5’ tag sequences) but heterogeneous 3’ ends (containing variable amounts of downstream repeat sequences). These crRNA forms are distinct from Cmr-associated crRNAs, indicating different 3’ end processing pathways following primary cleavage of common pre-crRNAs. We predict that the newly identified Pfu Type I-A (Csa) and Type I-G (Cst)-containing crRNPs, like other previously characterized Type I CRISPR-Cas effector complexes, each function by carrying out crRNA-guided DNA targeting of invading mobile genetic elements. Taken together, our in-depth characterization of the three isolated native complexes provides clear evidence for three compositionally distinct crRNPs containing either Cmr, Csa, or Cst Cas proteins that together make up an impressive arsenal of CRISPR-Cas defense for a single organism. 4 Samples: Protein-associated small RNAs

Dataset Information

Systematic interrogation of CRISPR-based antimicrobials in Klebsiella pneumoniae reveals nuclease-, guide-, and strain-specific factors influencing antimicrobial activity

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets