Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper

ABSTRACT: Alternative splicing (AS) is a widely observed phenomenon in eukaryotes that plays a critical role in development and stress responses. In plants, the large number of RNA-seq datasets in response to different environmental stressors can provide clues for identification of condition-specific and/or common AS variants for preferred agronomic traits. We report RNA-seq datasets (350.7 Gb) from Capsicum annuum inoculated with one of three bacteria, one virus, or one oomycete and obtained additional existing transcriptome datasets. In this study, we investigated the landscape of AS in response to environmental stressors, signaling molecules, and tissues from 425 total samples comprising 841.49 Gb. In addition, we identified genes that undergo AS under specific and shared stress conditions to obtain potential genes that may be involved in enhancing tolerance to stressors. We uncovered 1,642,007 AS events and identified 4,354 differential alternative splicing (DAS) genes related to environmental stressors, tissues, and signaling molecules. This information and approach provide useful data for basic-research focused on enhancing tolerance to environmental stressors in hot pepper or establishing breeding programs.

ORGANISM(S): Capsicum annuum

PROVIDER: GSE240234 | GEO | 2023/08/07

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA385363]

Project description:Alternative splicing (AS) is a widely observed phenomenon in eukaryotes that plays a critical role in development and stress responses. In plants, the large number of RNA sequencing (RNA-seq) datasets in response to different environmental stressors can provide clues for identification of condition-specific and/or common AS variants for preferred agronomic traits. In this study, we report five RNA-seq datasets (350.7 Gb) inoculated with one of three bacteria, one virus, or one oomycete. In addition, we obtained existing transcriptome datasets in response to abiotic and biotic stressors, phytohormones, and various developmental stages. From 428 total samples comprising 841.49 Gb, we identified the AS landscape in C. annuum. We further uncovered 1,704,387 AS events through differential AS analysis and identified 6,280 differential alternative splicing (DAS) genes related to environmental stressors, developmental stages, and phytohormones. This information and approach will enable comparative analysis of differential AS from RNA-seq datasets. Additionally, our findings provide useful data for basic-research programs focused on enhancing tolerance to environmental stressors in hot pepper or establishing breeding programs.

2023-08-21 | GSE240945 | GEO

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA987837]

2023-08-21 | GSE240944 | GEO

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA973829]

2023-08-21 | GSE240943 | GEO

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA223222]

2023-08-21 | GSE240946 | GEO

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA634831]

2023-08-21 | GSE240948 | GEO

The landscape of abiotic and biotic stress-responsive splice variants with deep RNA-seq datasets in hot pepper [PRJNA525913]

2023-08-21 | GSE240947 | GEO

Transcription profiling of rice indica after glycinebetaine-induced water-stress tolerance in codA-expressing transgenics

Project description:Glycinebetaine-induced water-stress tolerance in codA-expressing transgenic indica rice is associated with up-regulation of several stress responsive genes. Rice (Oryza sativa L.), a non-accumulator of glycinebetaine (GB), is highly susceptible to abiotic stress. Transgenic rice with chloroplast-targeted choline oxidase encoded by the codA gene from Arthrobacter globiformis has been evaluated for inheritance of transgene up to R5 generation and water-stress tolerance. During seedling, vegetative and reproductive stages, transgenic plants could maintain higher activity of photosystem II and they show better physiological performance, e.g. enhanced detoxification of reactive oxygen species compared to wild-type plants under water-stress. Survival rate and agronomic performance of transgenic plants is also better than wild-type following prolonged water-stress. Choline oxidase converts choline into glycinebetaine and H2O2 in a single step. It is possible that H2O2 /GB might activate stress response pathways and prepare transgenic plants to mitigate stress. To check this possibility, microarray-based transcriptome analysis of transgenic rice has been done. It unraveled altered expression of many genes involved in stress responses, signal transduction, gene regulation, hormone signaling and cellular metabolism. Overall, 165 genes show more than 2 folds up-regulation at P value <0.01 in transgenic rice. Out of these, at least 50 genes are known to be involved in plant stress response. Exogenous application of H2O2 or GB to wild-type plants also induces such genes. Our data show that metabolic engineering for GB is a promising strategy for introducing stress tolerance in crop plants and which could be imparted, in part, by H2O2- and/or GB-induced stress response genes. Experiment Overall Design: Rice (Oryza sativa L.), transgenic plants expressing codA gene from Arthrobacter globiformis were compared with untransformed plants at seedling level

2009-06-24 | E-GEOD-15448 | biostudies-arrayexpress

Project description:Stordalen Mire Environmental Datasets

| PRJNA482249 | ENA

RNA Capture-Seq resolves the deep complexity of the human transcriptome (454)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress

RNA Capture-Seq resolves the deep complexity of the human transcriptome (Illumina)

Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic gene deserts. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/

2011-09-12 | E-GEOD-29038 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data