Aging aggravates aortic aneurysm and dissection via the miR-1204-MYLK signaling axis
Ontology highlight
ABSTRACT:
ORGANISM(S): Merkel cell polyomavirus Human gammaherpesvirus 8 Human alphaherpesvirus 2 JC polyomavirus Betapolyomavirus macacae Homo sapiens Human immunodeficiency virus 1 Human betaherpesvirus 5 Herpesvirus saimiri (strain 11) Human alphaherpesvirus 1 Betapolyomavirus hominis Human betaherpesvirus 6B Macacine alphaherpesvirus 1 human gammaherpesvirus 4
PROVIDER: GSE253747 | GEO | 2024/04/02
REPOSITORIES: GEO
Similar Datasets
Project description:The mechanism by which aging induces aortic aneurysm and dissection (AAD) remains unclear. A total of 430 subjects were recruited for screening of differentially expressed plasma microRNAs. We found that miR-1204 was significantly increased in both plasma and aorta of elder patients with AAD, and was positively correlated with age. Cell senescence induced the expression of miR-1204 through p53 interaction with plasmacytoma variant translocation 1, and miR-1204 induced vascular smooth muscle cell (VSMC) senescence to form a positive feedback loop. miR-1204 aggravated angiotensin II-induced AAD formation, and inhibition of miR-1204 attenuated β-aminopropionitrile monofumarate-induced AAD formation. Mechanistically, miR-1204 directly targeted myosin light chain kinase (MYLK) to promote VSMCs to acquire senescence-associated secretory phenotype (SASP) and lose their contractile phenotype. Overexpression of MYLK reversed miR-1204-induced VSMC senescence, SASP and contractile phenotype changes, and the decrease of transforming growth factor-β signaling pathway. Our findings suggest aging aggravates AAD via miR-1204-MYLK signaling axis.
2024-04-01 | PXD048658 | Pride
Project description:The mechanism by which aging induces aortic aneurysm and dissection (AAD) remains unclear. We found that miR-1204 was significantly increased in both plasma and aorta of elder patients with AAD, and was positively correlated with age. Cell senescence induced the expression of miR-1204 through p53 interaction with plasmacytoma variant translocation 1, and miR-1204 induced vascular smooth muscle cell (VSMC) senescence to form a positive feedback loop.
2024-04-02 | GSE255157 | GEO
Project description:BACKGROUND: Thoracic aortic dissection (TAD) and abdominal aortic aneurysm (AAA) are fatal cardiovascular diseases with a high mortality rate in rupture events, closely related to vascular smooth muscle cell (VSMC) transformation from contractile to synthetic type and extracellular matrix degradation. NFATc3 in macrophages has recently been revealed as an atherosclerosis and foam cell formation negative regulator. However, the role of NFATc3 in aortic aneurysm and dissection (AAD) remains unknown. Therefore, we aimed to investigate the role of VSMC in NFATc3 in developing AAD and establishing NFATc3 as a novel target to treat AAD. METHODS: NFATc3 expression was measured in human and mouse aortic dissection and aneurysm samples. To investigate the role of VSMC-NFATc3 in AAD, we generated VSMC-specific NFATc3 knockout and knockin mice from three different murine AAD models, including proprotein convertase subtilisin/kexin type 9/ AngII (angiotensin II), β-aminopropionitrile (BAPN)/AngII models and BAPN models. The molecular mechanisms underlying NFATc3 function were investigated using RNA-seq analysis, mass spectrometry analysis, gelatin zymography, a luciferase reporter assay ChIP-qPCR, nuclear run-on assay, polyribosome profiling, coimmunoprecipitation, and mammalian 2-hybrid assay. RESULTS: We found that cytoplasmic and nuclear NFATc3 levels are elevated in human and mouse aortic dissection aneurysms. VSMC-specific NFATc3 deletion in mice reduced TAD and AAA progression, whereas VSMC-specific NFATc3 overexpression mice exhibited the opposite phenotype. VSMC-NFATc3 aggravated AAD independently of blood pressure regulation. VSMC-specific NFATc3 deletion reduces extracellular matrix degradation and maintains VSMC contractile phenotype. Mechanistically, nuclear NFATc3 specifically targeted and transcriptionally up-regulated MMP9 and MMP2, promoting extracellular matrix degradation and AAD development. We found that NFATc3 promoted VSMC phenotypic switch by binding to eEF2 and inhibiting its phosphorylation in VSMC cytoplasm, increasing protein synthesis and translational elongation, downregulating VSMC differentiation markers, and eventually exacerbating AAD development. We found that cabamiquine, a novel antimalarial agent that targets eEF2 and inhibits protein synthesis, inhibited AAD development and progression in VSMC-specific NFATc3 overexpression mice. Conclusion: Thus, VSMC-NFATc3 promotes VSMC change from contractile to synthetic type and extracellular matrix degradation, exacerbating AAD development, suggesting that VSMC-NFATc3 is a novel therapeutic target for preventing and treating AAD.
2023-06-08 | PXD042816 |
Project description:Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-β-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1-dependent and –independent pathways
2016-05-03 | GSE80972 | GEO
Project description:Introduction: Amplification at chromosome 8q24 is one of the most frequent genomic abnormalities in human cancers and is associated with reduced survival duration in breast and ovarian cancers. The minimal amplified region encodes c-MYC and the non-coding RNA, PVT1 including miR-1204 encoded in exon 1b. Here we analyzed the genomic changes at chromosome 8q24.21 in breast cancer and the functional roles of miR-1204 in breast and ovarian cancer progression. Methods: The genomic changes at chromosome 8q24.21 were detected in 997 breast cancer tumors and 40 breast cancer cell lines. Expression of miR-1204 in breast and ovarian cancer cell lines was investigated by qRT-PCR method. The role of miR-1204 in the tumorigenesis of breast and ovarian cancer was explored using both knockdown and overexpression of miR-1204 in vitro. Candidate miR-1204 target genes from two independent expression microarray datasets and computational predict programs were identified and further validated by qRT-PCR and western blot methods. The role of inhibition of miR-1204 on tamoxifen sensitivity in breast cancer cells was also investigated. Results: MiR-1204 is frequently co-amplified with MYC and expression of miR-1204 is strongly correlated with the expression and amplification of the noncoding PVT1 transcript and less so with MYC in human breast and ovarian cancer cells. Inhibition of miR-1204 decreases cell proliferation and increased apoptosis in breast and ovarian cancer cell lines with 8q24 amplification, but not in lines without amplification and so may be involved in Myc-induced apoptosis. Additionally, overexpression of miR-1204 enhances both breast and ovarian cancer cell growth and Myc-initiated Rat1A cell transformation. Computational and experimental analyses 30 promising candidate miR-1204 target genes. mRNA levels for these genes were assessed after over expression and knockdown of miR-1204 as were protein levels for 10 genes for which antibodies were available. These studies implicated VDR and ESR1 as miR-1204 targets. Inhibition of miR-1204 increased response to tamoxifen in Estrogen Receptor negative breast cancer cell lines. Conclusions: We conclude that amplification of miR-1204 contributes to breast and ovarian pathophysiology at least in part, by increasing proliferation and down regulating apoptosis and by decreasing expression of VDR and ESR1. Seven cell line sample pairs, where samples are LNA transfected with antimiR-1204 or antimiR-1204 control
2012-04-30 | E-GEOD-37185 | biostudies-arrayexpress
Project description:Myocardin (Myocd) plays an important role in the maintenance and homeostasis of the vasculature. The loss of Myocd results in vascular smooth muscle cell (VSMC) phenotypic transition and thoracic aortic aneurysms and dissections (TAADs) by downregulating VSMC contractile genes. VSMC phenotypic transition plays a key role in the formation of abdominal aortic aneurysms and dissections (AAADs). However, little is known about the role of Myocd in AAAD. The effect of Myocd on AAA formation was proven in an angiotensin II (Ang II)-induced AAD model. Myocd overexpression or knockdown was achieved by the injection of the corresponding adeno-associated virus serotype 9 (AAV9) through the tail vein. The knockdown of Myocd in C57BL/6J mice treated with angiotensin II promoted the formation of AAAD, as demonstrated by increases in the maximal aortic diameter, vascular inflammation and elastin degradation relative to the control group, while Myocd-overexpressing ApoE-/- mice infused with Ang II were less likely to develop AAAD. Mechanistically, Myocd deficiency significantly repressed VSMC marker gene expression. In addition, qPCR results showed that Myocd knockdown promoted the expression of lncRNAs, which showed increased levels in human AAD tissues. Our results indicated the pivotal role of Myocd in protecting against AAAD formation.
2024-10-25 | GSE180990 | GEO
Project description:Oncogene-induced senescence (OIS) and therapy-induced senescence (TIS), while tumor-suppressive, also promote procarcinogenic effects by activating the DNA damage response (DDR), which in turn induces inflammation. This inflammatory response prominently includes an array of cytokines known as the senescence-associated secretory phenotype (SASP). Previous observations link the transcription-associated methyltransferase and oncoprotein MLL1 to the DDR, leading us to investigate the role of MLL1 in SASP expression. Our findings reveal direct MLL1 epigenetic control over proproliferative cell cycle genes: MLL1 inhibition represses expression of proproliferative cell cycle regulators required for DNA replication and DDR activation, thus disabling SASP expression. Strikingly, however, these effects of MLL1 inhibition on SASP gene expression do not impair OIS and, furthermore, abolish the ability of the SASP to enhance cancer cell proliferation. More broadly, MLL1 inhibition also reduces âÂÂSASP-likeâ inflammatory gene expression from cancer cells in vitro and in vivo independently of senescence. Taken together, these data demonstrate that MLL1 inhibition may be a powerful and effective strategy for inducing cancerous growth arrest through the direct epigenetic regulation of proliferation-promoting genes and the avoidance of deleterious OIS- or TIS-related tumor secretomes, which can promote both drug resistance and tumor progression. This study consists of a single replicate of RNA-seq from oncogene-induced senescent (or control) IMR90 cells in a MLL1 knockdown (or WT) background, for a total of four samples
2016-02-23 | E-GEOD-78138 | biostudies-arrayexpress
Project description:Oncogene-induced senescence provides a barrier against malignant transformation. Senescent cells secrete pro-inflammatory cytokines, chemokines and growth factors collectively known as the senescence-associated secretory phenotype (SASP). Paradoxically, the SASP can also negatively impact the neighbouring tissues through inducing an inflammatory environment that promotes tumorigenesis and aged-related pathologies. We have previously shown that the lncRNA MIR31HG is overexpressed and located in the cytoplasm during BRAF-induced senescence. In young proliferating cells, nuclear MIR31HG inhibits p16/CDKN2A expression through interaction with polycomb repressor complexes (PRC1/2). Here, we show that MIR31HG regulates the expression and secretion of a subset of SASP components during BRAF-induced senescence. The SASP secreted from senescent cells depleted for MIR31HG fails to induce paracrine invasion without affecting the growth inhibitory effect. Mechanistically, MIR31HG interacts with the translation factor YBX1 facilitating its phosphorylation at serine 102 (p-YBX1S102) by the kinase RSK. p-YBX1S102 induces IL1A translation which acts as upstream regulator inducing the transcription of the other SASP mRNAs. Our results suggest a dual role for MIR31HG in senescence depending on its cellular localization and place the lncRNA as a potential therapeutic target in the treatment of senescence-related pathologies.
2021-03-02 | PXD017475 | Pride
Project description:Oncogene-induced senescence (OIS) and therapy-induced senescence (TIS), while tumor-suppressive, also promote procarcinogenic effects by activating the DNA damage response (DDR), which in turn induces inflammation. This inflammatory response prominently includes an array of cytokines known as the senescence-associated secretory phenotype (SASP). Previous observations link the transcription-associated methyltransferase and oncoprotein MLL1 to the DDR, leading us to investigate the role of MLL1 in SASP expression. Our findings reveal direct MLL1 epigenetic control over proproliferative cell cycle genes: MLL1 inhibition represses expression of proproliferative cell cycle regulators required for DNA replication and DDR activation, thus disabling SASP expression. Strikingly, however, these effects of MLL1 inhibition on SASP gene expression do not impair OIS and, furthermore, abolish the ability of the SASP to enhance cancer cell proliferation. More broadly, MLL1 inhibition also reduces �SASP-like� inflammatory gene expression from cancer cells in vitro and in vivo independently of senescence. Taken together, these data demonstrate that MLL1 inhibition may be a powerful and effective strategy for inducing cancerous growth arrest through the direct epigenetic regulation of proliferation-promoting genes and the avoidance of deleterious OIS- or TIS-related tumor secretomes, which can promote both drug resistance and tumor progression. This study examines the genome-wide distribution of gH2A.x and H3K4me3 by chIP-seq, using input and whole histone subunit H3 (respectively) as controls for local sonication efficiency bias. Each of the four chIPs has a single replicate each in (i) IMR90 fibroblasts transfected with a scramble control vector, (ii) the same cells subject to oncogene-induced senescence by stimulation of H-Ras V12, and (iii) in OIS cells with a shRNA targeting MLL1. Additionally, gH2A.x and input were sequenced with another replicate in control and OIS cells (both scramble control).
2016-02-23 | E-GEOD-78141 | biostudies-arrayexpress
Project description:Senescence is a cellular phenotype present in health and disease, characterized by an irreversible cell cycle arrest and an inflammatory response, denominated senescence-associated secretory phenotype (SASP). The SASP is important in influencing the behaviour of neighbouring cells and altering the microenvironment; yet, this role has been mainly attributed to soluble factors. Here, we show that both the soluble factors and extracellular vesicles (EV) (comprised of exosomes and small extracellular vesicles) are capable of transmitting paracrine senescence to nearby cells. Analysis of the individual cells internalizing sEV, using a Cre-reporter system, suggest a positive correlation between sEV uptake from senescent cells and paracrine senescence. Interestingly, we find exosome biogenesis increased during senescence in vivo. sEV protein characterization by Mass Spectrometry (MS) followed by a functional siRNA screen identify the Interferon Induced Transmembrane Protein 3 (IFITM3) as partially responsible for transmitting senescence to normal cells. Altogether, we found that sEV are part of the SASP and contribute to paracrine senescence
2019-06-25 | PXD010379 | Pride