Dataset Information

Genomics data for CCl4-induced mice liver fibrosis

ABSTRACT: Objective: To understand the transcriptome data of liver fibrosis induced by CCl4 in mice.Methods: C57BL/6 mice were used to duplicate the liver fibrosis model induced by CCl-4.After successful replication, mouse RNA was extracted for subsequent experiments.The basic principle of RNA extraction is to prevent RNA degradation during extraction, maximize RNA extraction efficiency, and ensure the extraction of high-quality RNA with good integrity and purity from target samples.According to the species (such as animal sample or plant sample) and sample status (such as animal tissue or animal cell) of the sample, select the appropriate extraction reagent and corresponding extraction method.The detection of high-quality RNA in samples is the basis for the success of the whole project. In order to ensure the accuracy of sequencing data, we performed quality inspection on samples, and the library construction can only be performed after the detection results meet the requirements for sequencing library construction.Sample test results are shown in the quality inspection report.After the library construction samples passed the test, the mRNA of eukaryotes was enriched with magnetic beads with Oligo (dT).Subsequently fragmentation buffer was added to randomly interrupt the mRNA.First-strand cDNA was synthesized using mRNA as a template with a six-base random primer (random hexamers), followed by buffer, dNTPs, and DNA polymerase I to synthesize the second-strand cDNA, which was subsequently purified using AMPure XP beads.Purified double-stranded cDNA was then end-repaired, A-tailed and ligated with sequencing adapters, followed by fragment size selection with AMPure XP beads, and finally PCR enrichment to obtain the final cDNA library.After library construction, insert size and effective concentration of the library were tested to ensure library quality.After passing the library test, different libraries were pooling according to the amount of data under the target and sequenced on the machine.RESULTS: RNA-seq data of CCL4-induced liver fibrosis model in mice were finally obtained in our experiment, which provided a molecular biological basis for our future study of liver fibrosis in mice.

ORGANISM(S): Mus musculus

PROVIDER: GSE276686 | GEO | 2025/02/12

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Human placenta bulk mRNA-sequencing from n=124 first trimester (59 female, 65 male) and n=43 third trimester (18 female, 25 male) tissue samples. A subset of 23 pregnancies has matched placenta tissue collected at both first and third trimester. Tissue was collected at Cedars-Sinai Medical Center in Los Angeles, California, USA. First trimester placenta was collected at gestational ages of 70-100 days from leftover tissue from chorionic villus sampling for prenatal genetic diagnosis, after cleaning to remove maternal decidua. Third trimester placenta was collected after delivery at gestational ages 254-290 days from the fetal side near the umbilical cord insertion site beneath the amnion. Tissue was stored in RNAlater RNA Stabilization Solution (Invitrogen) at -80C until further processing. All pregnancies were conceived without fertility treatments, were normal karyotype, and resulted in live singleton births. Mothers with pre-existing diabetes or hypertension were excluded from the study, but not excluded if complications developed during pregnancy, though most pregnancies were uncomplicated. The average parental age was advanced (over 35 years old) but principal components analysis did not show clustering by either maternal or paternal age. RNA extraction was performed with physical homogenization of tissue followed by the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN), then 1 ug of the total RNA elution was used for library construction using the Illumina TruSeq Stranded mRNA library preparation kit (Illumina), with polyA mRNA selection then cDNA synthesis using SuperScript II reverse transcriptase (Invitrogen) and random primers. The cDNA was converted into double stranded DNA and PCR-amplified, then purified with Agencourt AMPure XP beads (Beckman Coulter). Sample libraries were multiplexed and sequenced on a NovaSeq 6000 platform (Illumina) using 75bp single-end mRNA-sequencing, with average 30 million reads per sample. Differential expression analysis was performed with DEseq2 to compare first versus third trimester placenta, adjusted for fetal sex [PubMed ID: 38271627]. Subanalyses were also performed to identify sex differences.

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Dataset Information

Genomics data for CCl4-induced mice liver fibrosis

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets