Dataset Information

Joint single-cell profiling of Cas9 edits and transcriptomes determines on- and off-target regulatory effects

ABSTRACT: A longstanding barrier in genome engineering with CRISPR-Cas9 has been the inability to measure Cas9 edit outcomes at single-cell resolution. Here we present Superb-seq, a new technology for joint measurement of on-target and off-target Cas9 edits and transcriptomes by single-cell RNA sequencing. In contrast to Perturb-seq methods that read each cell’s guide RNA, Superb-seq directly reads Cas9 edits by leveraging T7 in situ transcription. We performed Superb-seq on 9,500 K562 cells, targeting four chromatin remodeler genes with seven guide RNAs. Superb-seq identified 11,891 edit events in 6,230 edited cells at all seven on-target sites and at 36 off-target sites. One notable off-target edit fell within the first intron of the deubiquitinase gene USP9X, which decreased its expression and perturbed the expression of downstream genes. Superb-seq uses off-the-shelf kits, standard equipment, and requires no virus, which will enable CRISPR screens in virus-intolerant cell types and functional characterization of off-target events.

ORGANISM(S): Homo sapiens

PROVIDER: GSE284207 | GEO | 2025/02/25

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Joint single-cell profiling of Cas9 edits and transcriptomes determines on- and off-target regulatory effects

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets