Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

HCaRG vs NEO

ABSTRACT: Summary: HEK293 cells were transfected with control plasmid (pcDNA1/Neo; Invitrogen) or with the plasmid encoding HCaRG by a standard calcium phosphate co-precipitation method. The clones expressing the highest levels of HCaRG, HCaRG clone 8 and 9 were used in this experiment, while clone transfected with vector alone, Neo clone, served as control. Stable transfectants were synchronized and grown in the presence of 10% FBS for 48 h. Total RNAs were purified with the mini RNeasy kit (Qiagen). Keywords: parallel sample

ORGANISM(S): Homo sapiens

PROVIDER: GSE4737 | GEO | 2006/10/27

SECONDARY ACCESSION(S): PRJNA95675

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcription profiling of human HEK cells transfected with the calcium regulated gene HcARG reveals HCaRG increases renal cell migration by a TGF-alpha autocrine loop mechanism

Project description:HEK293 cells were transfected with control plasmid (pcDNA1/Neo; Invitrogen) or with the plasmid encoding HCaRG by a standard calcium phosphate co-precipitation method. The clones expressing the highest levels of HCaRG, HCaRG clone 8 and 9 were used in this experiment, while clone transfected with vector alone, Neo clone, served as controls. Stable transfectants were synchronized and grown in the presence of 10% FBS for 48 h. Total RNAs were purified with the mini RNeasy kit (Qiagen).

2007-11-11 | E-GEOD-4737 | biostudies-arrayexpress

HCaRG-9 vs NEO-1

Project description:HEK293 cells were transfected with control plasmid (pcDNAI/Neo;Invitrogen) or with the plasmid encoding HCaRG. Stable transfectants were synchronized and grown in the presence of 10% FBS for 48 h. Total RNAs were purified with the mini RNeasy kit (Qiagen). Chips HG-U133A: - Labeling protocol: Enzo BioArray HighYield RNA Transcript Labeling Kit. - Hybridization: According to the manufacturer's protocol (Affymetrix). - Scanner: GeneArray 2500. - Normalization: Employing GCOS software, chips were normalized using all probe sets scaling option and target signal at 500. Chips HG-U133 Plus 2.0: - Labeling protocol: GeneChip IVT Labeling Kit. - Hybridization: According to the manufacturer's protocol (Affymetrix). - Scanner: GeneChip Scanner 3000. - Normalization: Employing GCOS software, chips were normalized using all probe sets scaling option and target signal at 500. Keywords: parallel sample

2005-10-19 | GSE2555 | GEO

Transcription profiling of human HCaRG-9 cells vs NEO-1 cells to identified differentially expressed genes between HCaRG9 and Neo1 cells

Project description:HEK293 cells were transfected with control plasmid (pcDNAI/Neo;Invitrogen) or with the plasmid encoding HCaRG. Stable transfectants were synchronized and grown in the presence of 10% FBS for 48 h. Total RNAs were purified with the mini RNeasy kit (Qiagen). Chips: HG-U133A; - Labeling protocol: Enzo BioArray HighYield RNA Transcript Labeling Kit. - Hybridization: According to the manufacturer's protocol (Affymetrix). - Scanner: GeneArray 2500. - Normalization: Employing GCOS software, chips were normalized using all probe sets scaling option and target signal at 500. Chips: HG-U133 Plus 2.0; - Labeling protocol: GeneChip IVT Labeling Kit. - Hybridization: According to the manufacturer's protocol (Affymetrix). - Scanner: GeneChip Scanner 3000. - Normalization: Employing GCOS software, chips were normalized using all probe sets scaling option and target signal at 500.

2007-09-07 | E-GEOD-2555 | biostudies-arrayexpress

Identification of de novo LINE-1 (L1) retrotransposon integration sites in HeLa S3 cells by ATLAS-seq-neo (unselected insertions)

Project description:We used ATLAS-seq-neo to map the sites of integration of an engineered LINE-1 (L1) retrotransposon into the genome of HeLa S3 cells. In brief, we transfected cells with a plasmid-borne L1.3 element carrying a neomycin-resistance-based retrotransposition cassette, as well as a hygromycin-resistance cassette on the plasmid backbone. For this set of experiments, cells were only selected for transfection (hygromycin) but not for retrotransposition (neomycin). Then we prepared ATLAS-seq-neo libraries. Each sample corresponds to an independent transfection and pool of hygromycin-resistant cells. ATLAS-seq-neo relies on the random mechanical fragmentation of the genomic DNA to ensure high-coverage, ligation of adapter sequences, suppression PCR-amplification of the 3' end L1 junction with its flanking genomic sequence, and Ion Torrent sequencing using single-end 400 bp read chemistry. The primer used for suppression PCR specifically targets the engineered element and not endogenous copies as in the original ATLAS-seq protocol (Philippe et al. eLife 2016). For some libraries, the linker-ligated genomic DNA was digested with BamHI, which cuts downstream of L1 polyA site in the plasmid backbone, to limit amplification from the plasmid and enrich for retrotransposition-mediated insertion events into the genomic DNA.

2019-04-03 | E-MTAB-7644 | biostudies-arrayexpress

Identification of de novo LINE-1 (L1) retrotransposon integration sites in HeLa S3 cells by ATLAS-seq-neo

2019-04-04 | E-MTAB-6933 | biostudies-arrayexpress

Transcriptome sequencing of Serpine1-overexpression MLE-12 cells

Project description:To determine the function of Serpine1 in alveolar cells, the Serpine1 overexpression plasmid pCI-neo-Serpine1 was constructed and transfected into MLE-12 cells

2022-10-05 | GSE212689 | GEO

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).

2014-07-22 | GSE51441 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

miRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:In order to determine the effect of neoR gene in Q175 locus, miRNASeq was performed to compare the transcriptional signatures of zQ175 knock-in neo-in (z_Q175 KI) (CHDI-81003003) and zQ175 KI neo-out (Z_Q175 (neo -) KI) (CHDI-81003019) mouse lines. The z_Q175 KI is a knock-in mouse line with humanized exon 1 (190-200 pure CAG repeats) derived from Q140 KI colony. It contains floxed neo cassette upstream of exon 1. The Z_Q175 KI (neo -) KI was generated by crossing the Z-Q175 KI line with a zp3-cre transgenic line to delete out the neo cassette.

2018-12-19 | GSE123664 | GEO

mRNASeq of z_Q175 knock-in mouse lines with and without neo cassette

Project description:In order to determine the effect of neoR gene in Q175 locus, mRNASeq was performed to compare the transcriptional signatures of zQ175 knock-in neo-in (z_Q175 KI) (CHDI-81003003) and zQ175 KI neo-out (Z_Q175 (neo -) KI) (CHDI-81003019) mouse lines. The z_Q175 KI is a knock-in mouse line with humanized exon 1 (190-200 pure CAG repeats) derived from Q140 KI colony. It contains floxed neo cassette upstream of exon 1. The Z_Q175 KI (neo -) KI was generated by crossing the Z-Q175 KI line with a zp3-cre transgenic line to delete out the neo cassette.

2018-12-19 | GSE123657 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data