Gene expression profiling of CREB knockdown in Acute Lymphoblastic Leukemia cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE68413 | GEO | 2015/04/30
SECONDARY ACCESSION(S): PRJNA282674
REPOSITORIES: GEO
Similar Datasets
Project description:Gene expression profiling was performed to examine genetic consequences that resulted from shRNA mediate knockdown of CREB in the four ALL cell lines Jurkat, Nalm6, Molt4, and RS4;11 using two CREB shRNAs. Leukemic cells were incubated with lentiviral supernatants for one or two consecutive days after which stably transduced cells were expanded. Transduced cells were pelleted and total RNA was isolated from CREB or scrambled transduced cells. The quality control, RNA labeling, hybridization, and data extraction was profiled on Illumina Human v2 Expression BeadChips, all performed at ServiceXS B.V.
2015-04-30 | E-GEOD-68413 | biostudies-arrayexpress
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress
Project description:This study characterized the effect of WEE1 kinase inhibition using AZD1775 treatment on single-cell gene expression profile using the 10x Genomics protocol in the acute lymphoblastic leukemia cell lines RS4;11 (KMT2A-rearranged subtype) and Nalm6 (other subtype).
2023-05-14 | GSE218621 | GEO
Project description:After identifying cofactors that affected the sensitivity of dex-induced cell death in B-ALL, we knocked down three cofactors, NCAO2, EHMT1, and EHMT2, using shRNAs in NALM6 cells After measuring the effect of cofactor knockdown on dex-sensitivity of these cells, we looked at differences in gene expression after exposure to dexamethasone.
2018-08-24 | GSE118992 | GEO
Project description:RNAi mediated knockdown of BTG1 in the acute lymphoblastic cell line RS4;11 causes this cell line to become resistant to prednisolone treatment when compared to control cells. In this experiment we treated BTG1 knockdown RS4;11 cells and control RS4;11 cells either with prednisolone or a vehicle control and compared the gene expression patterns of these cell lines. 8 samples were analyzed: we treated RS4;11 control or RS4;11 shRNA BTG1 cells with either prednisolone or vehicle control, the experiment was performed in duplicate. Genes with a > 2-fold change in expression after prednisolone treatment when compared to vehicle treatment were selected. Expression changes in BTG1 knockdown cells were compared to those in control vector transduced cells.
2010-06-23 | E-GEOD-18027 | biostudies-arrayexpress
Project description:miRNA profiling of Jurkat T-ALL cells after knockdown with two control shRNAs and two shRNAs targeting TAL1 to identify miRNAs that are regulated by TAL1 miRNA profiling using Exiqon arrays 48hrs after transduction of Jurkat cells with two control shRNAs (pLKO1-GFP and pLKO1-LUCIFERASE) vs two shRNAs targeting TAL1 (pLKO1-shRNA1 and pLKO1-shRNA2). Biological duplicates per shRNA. One replicate per array.Total of 8 arrays.
2013-06-15 | E-GEOD-46957 | biostudies-arrayexpress
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle.
2008-08-30 | GSE12056 | GEO
Project description:Transcription factor CREB regulates lens Epithelial-Mesenchymal Transition（EMT）in both S133 phosphorylation dependent and independent manners. We found that S133A-CREB can activate lens EMT, while R314A-CREB attenuated it. To understand the mechanism by which S133A-CREB and R314A-CREB modulates EMT gene expression. ChIP assay using CREB antibody in the in the mouse lens epithelial cells alpha-TN4 overexpressing Vector, WT-CREB, S133A-CREB, R314A-CREB and S133A/R314A-CREB, and ChIP-seq was conducted on the ChIP DNA. We found that WT-CREB, S133A-CREB as well as R314A-CREB binds to the promoter regions of mesenchymal genes, and S133A-CREB retained canonical CREB binding motif, while R314A-CREB exhibited shifted binding motif preference to ATF1.
2025-02-05 | GSE276462 | GEO
Project description:Mucoepidermoid carcinomas (MEC) is the most common salivary gland malignancy. To date, advanced and nonresectable MEC have poor prognosis and no effective treatment. The CRTC1-MAML2 fusion oncogene, which is associated with more than 50% of MEC, consists of the N-terminal CREB-binding domain of the CREB transcriptional co-activator CRTC1 and the C-terminal transcriptional activation domain of the Notch transcriptional co-activator MAML2. CRTC1-MAML2 fusion was found to interact with CREB and constitutively activate their transcriptional targets. To investigate the contribution of the transcription factor CREB to mediate the fusion target gene expression, gene expression profiling analysis were performed in two salivary gland tumor cell lines (including fusion-positive H3118 MEC cells and fusion-negative HSY parotid adenocarcinoma cells) before and after CREB knockdown. This study demonstrated that CRTC1-MAML2 co-activation of CREB is a major mechanism underlying CRTC1-MAML2-mediated transcriptional regulation. Two salivary gland tumor cell lines were used in this study, including fusion-positive H3118 MEC cells and fusion-negative HSY parotid adenocarcinoma cells. The CREB knock down was performed with three biological replicates for each group. Both fusion-positive MEC H3118 cells and fusion-negative parotid adenocarcinoma HSY cells were stably transduced with pLKO.1-based shRNA targeting luciferase gene (shLuc, control) or CREB (shCREB). The cells were independently cultured and RNAs were then harvested 72 hours after transduction for microarray analysis.
2015-10-30 | E-GEOD-49673 | biostudies-arrayexpress
Project description:CREB regulates lens EMT in both S133 phosphorylation dependent and independent manners. We found that S133A-CREB activated, while R314A-CREB attenuated lens mesenchymal marker gene Fn1 and Snail2. To better understand the mechanism by which S133A and R314A mutations modulate EMT gene expression. RNA-seq on the alpha-TN4 overexpressing Vector, WT-CREB, KCREB, R314A-CREB, S133A-CREB, S133A-KCREB and S133A/R314A -CREB before and after TGFβ treatment.
2025-02-05 | GSE276922 | GEO