Expression data from glioblastoma stem-like cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE68424 | GEO | 2015/05/31
SECONDARY ACCESSION(S): PRJNA282707
REPOSITORIES: GEO
Similar Datasets
Project description:Microarray-based gene expression analysis identified microRNAs and mRNAs differentially expressed in 5 glioblastoma spheroid cultures upon ATRA treatment. In this study, a set of 5 glioblastoma spheroid cultures was used to acquire microRNA expression profiles, leading to the identification of differentially expressed microRNAs between untreated and ATRA-treated cultures. In this study, a set of 5 glioblastoma spheroid cultures was used to acquire expression profiles of a total of 16,651 transcripts, leading to the identification of differentially expressed genes between untreated and ATRA-treated cultures by Significance Analysis of Microarray data.
2010-07-20 | E-GEOD-17227 | biostudies-arrayexpress
Project description:Overexpression of SOX4 in LN229 glioblastoma cells prevents their cell cycle We used microarrays to detail the global programme of gene expression in SOX4 overexpression LN229 cells compared with mock control LN229 cells
2014-09-30 | GSE51301 | GEO
Project description:The gene expression of an orthotopic mouse model developed from human glioblastoma neurospheres was compared between temozolomide treated and untreated mice.
2015-06-03 | GSE47809 | GEO
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:Overexpression of SOX4 in LN229 glioblastoma cells prevents their cell cycle We used microarrays to detail the global programme of gene expression in SOX4 overexpression LN229 cells compared with mock control LN229 cells SOX4 overexpression LN229 cells and and control LN229 cells were cultured in DMEM cell culture media for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain the genes regulated by SOX4 in glioblastoma cell lines.
2014-09-30 | E-GEOD-51301 | biostudies-arrayexpress
Project description:Comparison of gene expression patterns between neurospheres and adherent cells derived from a glioblastoma multiforme primary tumour
2006-12-31 | E-MEXP-551 | biostudies-arrayexpress
Project description:Brain tumor neurospheres (BTCSs) are cancer cells with neural stem cell-like properties found in the fatal brain tumor glioblastoma multiforme (GBM). These cells account for less than 1% of total tumor cells, are poorly differentiated and are believed to be involved in tumor induction, progression, treatment resistance and relapse. Specific miRNAs play important roles in modulating the proliferation and differentiation of neural stem cells, therefore, we aimed to identify miRNAs controlling differentiation in GBM-BTSCs through high throughput screening miRNA array profiling. We compared the miRNA expression profiles at the neurosphere state and upon 4 and 14days of differentiation by using LIMMA, finding 21 differentially expressed miRNAs : hsa-miR-103, hsa-miR-106a, hsa-miR-106b, hsa-miR-15b, hsa-miR-17, hsa-miR-19a, hsa-miR-20a, hsa-miR-25, hsa-miR-301a and hsa-miR-93 were found up-regulated upon differentiation, while hsa-miR-100, hsa-miR-1259, hsa-miR-21, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-23b, hsa-miR-27a, hsa-miR-27b, hsa-miR-29a and hsa-miR-29b were down-regulated. Expression of 11 of the 21 miRNAs was examined by qPCR and 7 of them were validated: hsa-miR-21, hsa-miR-29a, hsa-miR-29b, hsa-miR-221 and hsa-miR-222 increased their expression upon differentiation, while hsa-miR-93 and hsa-miR-106a were inhibited. Functional studies demonstrated that miR-21 over-expression induced the expression of glial and/or neuronal cell markers in the neurospheres, possibly due to SPRY1 targeting by miR-21 in these cells, while miR-221 and miR-222 inhibition at the differentiated state reduced the expression of those differentiation markers. On the other hand, miR-29a and miR-29b targeted MCL1 in the GBM neurospheres and increased apoptotic cell death. Gene expression in differentiated cells relative to neurospheres in four different glioblastoma cultures
2013-03-05 | E-GEOD-44841 | biostudies-arrayexpress
Project description:Eighteen independent neurospheres derived from patients affected by primary glioblastoma were grouped into “classical”, “mesenchymal” or “proneural” subtypes according to analysis of genetic lesions and gene expression profiling. Here we show that expression of the MET oncogene, encoding the tyrosine kinase receptor for HGF, associates with mesenchymal and proneural neurospheres (Met-pos-NS). Met expression is almost absent from classical neurospheres (Met-neg-NS), and mutually exclusive with amplification and expression of the EGF receptor gene. Met-pos-NS and Met-neg-NS display distinct growth factor requirements, differentiate along divergent pathways, and generate tumors with distinctive histological features. Met-pos-NS contain a variable percentage of Met positive (Methigh) and Met negative (Metneg) cells. After purification, only Methigh cells display clonogenic ability in vitro, and regenerate neurospheres containing both Methigh and Metneg cells. After in vivo transplantation, Methigh cells display highly enriched tumorigenic potential as compared with Metneg cells. At functional level, in Methigh cells, HGF concomitantly sustains proliferation, clonogenicity, expression of self-renewal markers, migration and invasion. These data show that Met is a functional marker of glioblastoma stem cells, and a candidate target for molecular diagnosis and therapy of a glioblastoma subset. 37 samples (17 replicate samples and 1 triplicate sample)
2012-10-05 | E-GEOD-36426 | biostudies-arrayexpress
Project description:It is currently challenging to adequately model the growth and migration of glioblastoma using 2D in vitro culture systems as they quickly lose the original, patient-specific identity and heterogeneity. However, with the advent of 3D cell cultures and human induced pluripotent stem cells (iPSCs)-derived cerebral organoids (COs), studies demonstrate that the glioblastoma-cerebral organoid (GLICO) co-culture model helps to preserve the phenotype of the patient-specific tissue. Here we aimed to set up such a model using mature COs and develop a pipeline for subsequent analysis of co-cultured glioblastoma. Our data demonstrates that the growth and migration of the glioblastoma cell line within the mature COs are significantly increased in the presence of extracellular matrix proteins, shortening the time needed for glioblastoma to initiate migration. We also describe in detail the method for the visualization and quantification of these migrating cells within the GLICO model. Lastly, we show that this co-culture model (and the human brain-like microenvironment) can significantly transform the gene expression profile of the established U87 glioblastoma cell line into proneural and classical glioblastoma cell types.
2023-02-22 | GSE216626 | GEO
Project description:Overexpression of miR-127-3p in LN229 glioblastoma cells promotes their migration and invasion in vitro and in vivo in xenograft models. We used microarrays to detail the global programme of gene expression in miR-127-3p overexpression LN229 cells compared with mock overexpression LN229 cells
2014-09-01 | GSE50173 | GEO