Cas9 target DNA specificity in vitro and in vivo (S. cerevisiae)
Ontology highlight
ABSTRACT:
ORGANISM(S): synthetic construct
PROVIDER: GSE79667 | GEO | 2016/06/10
SECONDARY ACCESSION(S): PRJNA316637
REPOSITORIES: GEO
Similar Datasets
Project description:Cas9, a CRISPR RNA-guided nuclease, has been rapidly adopted as a tool for biochemical and genetic manipulation of DNA. Although Cas9 offers remarkable specificity and versatility for genome manipulation, mis-targeted events occur. To extend the understanding of Cas9 target::homology requirements, we compared mismatch tolerance for a specific Cas9::gRNA complex in vitro and in vivo (in Saccharomyces cerevisiae). A variety of truncated and full-length gRNAs (with 17, 18, and 20 nucleotides of complementarity sequence) were used. In each case, we observed notable differences between in vitro and in vivo Cas9 cleavage specificity profiles, with a more stringent effect of mismatches on activity seen in vivo. Increased specificity of the 18 nt complementarity truncated gRNA was evident in vivo, but not in vitro. Overall, this study highlights differences in the specificity of Cas9 cleavage between controlled in vitro conditions and complex and chromatinized in vivo conditions. We adapted a previous high throughput sequencing approach (doi: 10.1093/nar/gku1102) to assess the effects of single base variants in vivo. We used a polymorphic random variant library matched to a specific trigger sequence (for which we used a segment from the C. elegans unc-22 gene, previously designated âunc-22Aâ (doi: 10.1093/nar/gku1102). Cas9 in vivo and in vitro assays were carried out with four different gRNAs incorporating sequence from the unc-22A trigger segment. The four segments incorporate 17 nt, 18 nt, 20 nt, and 20+G nt of unc-22A complementarity respectively. The retention is calculated based on PMID: 25399416. File names denote the experiment-> gRNAname_gRNAlength_(invitro or invivo)_(incubation or induction time)_IlluminaRunID.dat The files contain all normalized sequences in column one with their calculated retentions in column 2.
2016-06-10 | E-GEOD-79667 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Background: The CRISPR/Cas9 toolbox has recently been expanded to include approaches for modulating gene expression. To successfully build on this work, and apply it for answering biological questions, it is important to establish it in a broad range of circumstances. Genome-scale CRISPR interference (CRISPRi) has been used in human cells lines, however the rules for designing effective guide RNAs (gRNAs) in different organisms are not well known. We sought to determine rules that determine gRNA effectiveness at transcriptional repression in Saccharomyces cerevisiae. Results: We created an inducible single plasmid CRISPRi system for gene repression in yeast, and used it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identified previously-described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments allowed us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility were clearly more effective. We also found the best region to target gRNAs was between the transcription start site (TSS) and 200bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, point mutations were tolerated equally well by truncated (18 nt specificity sequence) and full length (20 nt) gRNAs, however, 18 nt gRNAs were generally less potent than full length gRNAs. Conclusions: Our results establish a powerful functional genomics screening method, provide rules for designing effective gRNAs for gene repression, and show that 18 nt and 20 nt gRNAs exhibit similar tolerance to mismatches in the target sequence. These findings will enable effective library design and genome-wide screening in many genetic backgrounds. An expression construct was created for inducible CRISPRi in yeast. Key features include ORFs expressing dCas9-Mxi1 and the tetracycline repressor (TetR), as well as a tetracycline inducible gRNA locus containing the RPR1 promoter with a TetO site, a NotI site for cloning new gRNA specificity sequences, and the constant part of the gRNA. When yeast containing this plasmid are grown in the absence of anhydrotetracycline (ATc) TetR binds the gRNA promoter and prevents PolIII from binding and transcribing the gRNA. This in turn prevents dCas9-Mxi1 from binding the target site. In the presence of ATc, TetR dissociates and gRNA is expressed, allowing dCas9-Mxi1 to bind its target locus, and repress gene expression. gRNA libraries were cloned into this construct and transformed into yeast to create pools. Experiments were conducted in which yeast pools were grown in inducing (+ATc) and non-inducing conditions (-ATc) in the presence of different drugs. After multiple generations of growth in these conditions, yeast plasmids were minipreped and the gRNA locus was PCRed and sequenced via MiSeq. Counts of each gRNA were compared in different conditions.
2016-01-18 | E-GEOD-71490 | biostudies-arrayexpress
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides. 118 samples anaylzed. Controls have con in sample name. To quantitatively measure cleavage efficiency of a single gRNA, we created a population of random variant target sequences to two gRNA targets. The targets used were "unc-22A", [a sequence from the well-characterized unc-22 gene of Caenorhabditis elegans], and "protospacer 4" (ps4), a previously characterized sequence from a natural spacer from S. pyogenes MGAS10750 . Using custom mixtures of oligonucleotide precursors for each base during chemical synthesis, a set of polymorphic target libraries ('Random Variant Libraries') were designed to have a baseline variation rate at each position. On each side of the gRNA homology and PAM regions, 6 bps of random sequence were added. The first base of intended gRNA homology is designated base 1 . The entire 35 bp random variant library mixture was cloned into a standard plasmid vector (pHRL-TK). Several thousand colonies from plates were washed in pools and prepared by standard plasmid preparation methods. The complexity of the libraries were estimated based on Illumina sequencing of the uncut libraries and filtering for minimum representation expected from the pooling. Approximately 1500-3000 unique species were obtained in the unc-22A libraries and 5000 unique sequences in the ps4 library (see Materials and Methods). To assay cleavage, purified Cas9 was first incubated with gRNA, followed by incubation with the variant library for various time points and under various conditions. DNA template is among the conditions varied in the experiments. After protein removal, flanking sequences outside of the target region are used for PCR amplification and plasmid cleavage was measured through loss of PCR products that span the region of interest. A set of perfectly matched targets and highly mutated versions present in the random variant library served as internal positive and negative controls respectively. A log retention score for each sequence in each experiment was calculated by quantifying the representation of each sequence before and after addition of the Cas9 protein. Two approaches were used for normalization: first we used a population of ps4 targets "spiked" into the library as an uncleaved control, second, we used a population of unc-22A targets with large numbers of variations from the perfect target (between 4 and 7), and hence likely limited if any cleavage. Equivalent results are obtained with these two normalization approaches (see Computational Methods for details). Retention scores are expressed as the log2 of the normalized ratio, so that a more negative retention score indicates efficient cleavage of substrate while a less negative score indicates less cleavage. Templates which are uncleaved will yield a retention score at or near zero. Comparisons between multiple experiments indicate strong correlation between independent retention measurements. GSM1410678-GSM1410761; AF_SOL*.dat' files contain the calculated final retentions for each experiment. Each experiment labeled: M-bM-^@M-^\AF_SOL_###_t###M-bM-^@M-^]. M-bM-^@M-^\AF_SOL_###M-bM-^@M-^] corresponds to the experiment run ID and M-bM-^@M-^\t###M-bM-^@M-^] corresponds to the incubation time of the experiment. For example AF_SOL_513_t360, corresponds to experiment 513 on the protospacer 4 guide and DNA target and the incubation time was 360 mins. The experimental conditions and ID can be found in the associated publication. GSM1544297-GSM1544332; unc*.dat file is a tab-delimited file of all considered sequences in each experiment. The names of the files and the AF_SOL_# run number can be found in the associated publication (Supplementary Materials) with the details of the conditions. Each filename starts with the type of gRNA used (either unc-22WT or the mutant version unc22C11G). The next number (#min) is indication of the time of incubation for the experiment and this is either followed by #pcr_AF_SOL_# or just AF_SOL_#. If followed by #pcr, that is the indication of the number of PCR cycles used in the experiments. Finally, AF_SOL_# denotes the sequencing run ID number.
2014-11-14 | E-GEOD-58426 | biostudies-arrayexpress
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:To recapitulate the t(2;5)(p23;q35) chromosomal translocation, activated T lymphocytes from healthy donors PBMC were transfected with the RNP complex composed of the protein Cas9 with gRNA NPM1 (targeting NPM1 gene) and gRNA ALK (targeting ALK gene). Control cells were wild-type CD4+ activated lymphocytes. Cells were grown for 10-15 days in vitro prior to engraftment in vivo. Mice engrafted with NPM1-ALK+ T-cells developed T-cell lymphoma after 2-5 months. To get insights into the molecular bases of NPM1-ALK transformation, we next established the transcriptomes at an early in vitro stage and in fully transformed in vivo models. For this, we performed RNAseq analysis from 3 groups: 1-in vitro wild-type CD4+ activated lymphocytes [n=3], 2-in vitro NA-engineered CD4+ lymphocytes [n=3] and 3-in vivo derived CD4+ lymphoma cells purified by flow cytometry to distinguish CD3+ [n=3] and CD3- populations [n=3].
2022-02-09 | E-MTAB-10924 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Cas9 target DNA specificity in vitro and in vivo (S. cerevisiae)
| PRJNA316637 | ENA
Project description:Background: The CRISPR/Cas9 toolbox has recently been expanded to include approaches for modulating gene expression. To successfully build on this work, and apply it for answering biological questions, it is important to establish it in a broad range of circumstances. Genome-scale CRISPR interference (CRISPRi) has been used in human cells lines, however the rules for designing effective guide RNAs (gRNAs) in different organisms are not well known. We sought to determine rules that determine gRNA effectiveness at transcriptional repression in Saccharomyces cerevisiae. Results: We created an inducible single plasmid CRISPRi system for gene repression in yeast, and used it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identified previously-described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments allowed us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility were clearly more effective. We also found the best region to target gRNAs was between the transcription start site (TSS) and 200bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, point mutations were tolerated equally well by truncated (18 nt specificity sequence) and full length (20 nt) gRNAs, however, 18 nt gRNAs were generally less potent than full length gRNAs. Conclusions: Our results establish a powerful functional genomics screening method, provide rules for designing effective gRNAs for gene repression, and show that 18 nt and 20 nt gRNAs exhibit similar tolerance to mismatches in the target sequence. These findings will enable effective library design and genome-wide screening in many genetic backgrounds.
2016-01-18 | GSE71490 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress