Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

ABSTRACT: The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

ORGANISM(S): Danio rerio

PROVIDER: GSE8076 | GEO | 2007/07/30

SECONDARY ACCESSION(S): PRJNA100913

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Shared Molecules

Only show the datasets with similarity scores above: 0.5

Threshold

0.5

Similar Datasets

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [RNA-seq]

Project description:We identified Nodal and Foxh1 downstream targets by performing RNA-seq of embryos either treated with small molecule SB431542 or microinjected morpholino anti-sense oligo against Foxh1.

2014-11-07 | GSE53653 | GEO

Transcription profiling of zebrafish embryos injected with a morpholino targeting LIN9

Project description:TÜAB zebrafish were maintained at 28.5 °C in in 1x Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca (NO3)2, 5 mM HEPES, pH 7.6, 0.0001 % Methylene blue). Morpholinos (Gene Tools, Philomath, OR) were designed against Danio rerio lin-9 homolog (Genebank accession NM_001044946). The morpholino (MO) sequences were MO-E1 5´-GTTAGTTTTATTACTCACTCTCGTC-3´ and 5-base mismatch morpholino MO-E1mis 5´-GTTACTTTTAATACTGACTGTCCTC-3´. 7 ng of morpholinos were injected into one cell-stage embryos. 20 embryos per condition (MO E1; MO E1mis) were pooled for RNA purification 24 h post fertilization. Using the two color Quick-Amp Labeling Kit (Agilent; 5190-0444) 100 ng of total RNA were used for cDNA synthesis, mRNA amplification and labeling according to manufacturers instructions. Transcriptional profiling was done on a zebrafish oligo array (Agilent; G2519F AMADID 019161) in a 4 x 44K slide format and analyzed as described before.<br>

2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress

Genome-wide analysis of Smad2 and FoxH1 binding sites in zebrafish blastula

Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.

2015-04-08 | GSE67648 | GEO

FoxH1 represses miR-430 during early embryonic development of zebrafish via non-canonical regulation

Project description:Using ChIP-Seq we examined the targets of FoxH1 in zebrafish embryos at the 6hpf epiboly-stage. The revealed reads could be mapped to more than 16,000 peaks included also the known targets like ndr1, lft2, pitx2, flh, foxa3 and lhx1a. Relevant for our study, we identify the conserved microRNA-430 family (miR-430) as a novel target of FoxH1.

2019-07-18 | GSE133990 | GEO

HEB and E2A function as SMAD/FOXH1 cofactors

Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.

2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress

Engagement of Foxh1 in chromatin regulation revealed by protein interactome analyses

Project description:Precise gene expression patterns, both in time and space, is required for developmental processes to properly progress. Early embryonic cell fates are specified through the coordinated integration of transcription factor activities and epigenetic states of the genome. Foxh1 is a key maternal transcription factor controlling the mesendodermal gene regulatory program. Proteomic interactome analyses using FOXH1 as a bait in mouse embryonic stem cells revealed that FOXH1 interacts with PRC2 subunits and Hdac1. Foxh1 physically interacts with Hdac1, and confers transcriptional repression of mesendodermal genes in the ectoderm. Our findings reveal a central role of Foxh1 in coordinating the chromatin states of the Xenopus embryonic genome.

2022-08-04 | GSE204990 | GEO

HEB and E2A function as SMAD/FOXH1 cofactors

2011-08-23 | GSE30146 | GEO

Genome-wide maps of binding sites of Nanog-like and Mxtx2 in blastula stage zebrafish embryos

Project description:Here, using ChIP-Seq, we examined the targets of Nanog-like and Mxtx2 in blastula stage zebrafish embryos. We found that Nanog-like bind to its known targets like Oct4, Sox2, and Nanog-like. Nanog-like also bound to genes involved in extraembryonic lineage differentiation, like gata3 and krt4 for EVL differentiation, and mxtx2 and slc26a1 for YSL differentiation, mesoderm specification like ntl and tbx3, cell movement like wnt11 and cxcr4b, and signaling genes like ndr1, bmp2b, fgf8a and wnt8a. The binding profile suggests that Nanog-like may play a versatile role involving many developmental processes. We found 11.3% of the genes (1751 out of all annotated 15500 zebrafish genes) and 43.6% of the YSL genes (118 out of 271 genes expressed in the YSL) were bound by Mxtx2, suggesting Mxtx2 bound directly to YSL genes to activate their expression Examination of Nanog-like and Mxtx2 binding sites in 3.5hpf and 4.5hpf zebrafish embryos

2011-12-28 | E-GEOD-34683 | biostudies-arrayexpress

Knockdown of slc2a10/glut10 in zebrafish embryos vs. controls

Project description:A zebrafish model of arterial tortuosity syndrome (ATS) was generated by knocking down the slc2a10/glut10 gene using antisense morpholino oligonucleotides (MO). Control morpholino treated embryos were used as controls. The samples were collected for gene expression profiling at 48 hours post fertilization. Experimental details and analyzed data are available in Willaert et al. Human Molecular Genetics 2011; doi: 10.1093/hmg/ddr555 Two-condition experiment, slc2a10 MO (7.5ng) treatment vs control MO (5ng) treatment. Biological replicates: 3 slc2a10 MO replicates, compared to a pooled sample of 3 control MO replicates with dye swap.

2011-12-17 | E-GEOD-34508 | biostudies-arrayexpress

Zebrafish (Danio rerio) 72hpf, WT control vs. MO-Prpf31 injected

Project description:Transcriptional profiling performed from total eye RNA extracts of wildtype control fishes versus Prpf31 morpholino injected larvae (at ~72hpf) two-condition experiment: wildtype zebrafish versus MO-Prpf31 injected zebrafish eye RNA; 6 replicates each (extraction from 6 pools (~200 eyes each) of controls and 6 pools MO-Prpf31 (~200 eyes each))

2010-05-06 | E-GEOD-20424 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data