Dataset Information

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA Methylation by dCas9 methyltransferases (CRISPRme) [ChIP-Seq]

ABSTRACT: Fusion of active protein domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been widely used for epigenome editing, but the specificities of these engineered proteins have still not been fully investigated. Targeted methylation of specific gene loci offers a direct approach to perturb DNA methylation-associated biological processes. In this study, we generated and validated the global off-target characteristics of CRISPR-guided DNA methyltransferases (CRISPRme) by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from S. pyogenes. Using targeted quantitative bisulfite pyrosequencing and whole genome bisulfite sequencing (WGBS), we prove that CRISPRme can efficiently methylate the CpG dinucleotides flanking its target sites in genomic loci (uPA and TGFBR3) in human cells (HEK293T) with CpG-methylation levels exceeding 70% for some target sites. Using qPCR, fluorescent reporter cells, and RNA sequencing, we found that CRISPRme can mediate transient inhibition of gene expression which appears to result from Cas9-mediated interference with transcription rather than de novo DNA methylation. Analyses of whole genome methylation did not identify global methylation changes, however a substantial number of CRISPRme off-target differentially methylated regions (DMR, over 6000) were still identified. The majority of these DMRs were hypermethylated both in cells expressing CRISPRme alone and cells expressing CRISPRme together with gRNAs. These off-target hypermethylated sites were enriched in gene bodies, introns, 5’UTR, CGI shores, Alu sequences, open chromatin and PAM rich regions, but not correlated with off-target binding sites predicted by ChIP-seq. Our results prove that CRISPRme allows for efficient RNA-guided methylation of endogenous CpGs, however with high frequencies of off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are still required.

ORGANISM(S): Homo sapiens

PROVIDER: GSE92261 | GEO | 2016/12/14

SECONDARY ACCESSION(S): PRJNA357195

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Fusion of active protein domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been widely used for epigenome editing, but the specificities of these engineered proteins have still not been fully investigated. Targeted methylation of specific gene loci offers a direct approach to perturb DNA methylation-associated biological processes. In this study, we generated and validated the global off-target characteristics of CRISPR-guided DNA methyltransferases (CRISPRme) by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from S. pyogenes. Using targeted quantitative bisulfite pyrosequencing and whole genome bisulfite sequencing (WGBS), we prove that CRISPRme can efficiently methylate the CpG dinucleotides flanking its target sites in genomic loci (uPA and TGFBR3) in human cells (HEK293T) with CpG-methylation levels exceeding 70% for some target sites. Using qPCR, fluorescent reporter cells, and RNA sequencing, we found that CRISPRme can mediate transient inhibition of gene expression which appears to result from Cas9-mediated interference with transcription rather than de novo DNA methylation. Analyses of whole genome methylation did not identify global methylation changes, however a substantial number of CRISPRme off-target differentially methylated regions (DMR, over 6000) were still identified. The majority of these DMRs were hypermethylated both in cells expressing CRISPRme alone and cells expressing CRISPRme together with gRNAs. These off-target hypermethylated sites were enriched in gene bodies, introns, 5’UTR, CGI shores, Alu sequences, open chromatin and PAM rich regions, but not correlated with off-target binding sites predicted by ChIP-seq. Our results prove that CRISPRme allows for efficient RNA-guided methylation of endogenous CpGs, however with high frequencies of off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are still required.

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA Methylation by dCas9 methyltransferases (CRISPRme) [ChIP-Seq]

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets