Dataset Information

Substrate profiling of the metalloproteinase ovastacin – Implications for its physiological function in mammalian fertilization

ABSTRACT: The metalloproteinase ovastacin is released by the mammalian oocyte upon fertilization and cleaves zona pellucida protein 2, a component of the surrounding extracellular matrix, at a distinct cleavage site. This limited proteolysis hardens the zona pellucida, abolishes sperm binding and thereby regulates fertility. Therefore, this process has to be tightly controlled by the plasma protein fetuin-B, an endogenous competitive inhibitor. At present, little is known about how the cleavage characteristics of ovastacin differ from closely related proteases. Physiological implications of ovastacin beyond ZP2 cleavage are still obscure. In this study, we employed N-terminal amine isotopic labeling of substrates (N-TAILS) contained in the secretome of mouse embryonic fibroblasts to elucidate the substrate specificity and the precise cleavage site specificity. Furthermore, we were able to unravel the physicochemical properties governing enzyme-substrate interactions. Eventually, we identified several potential physiological substrates with significance for mammalian fertilization. These results suggest that ovastacin might affect sperm interaction beyond zona pellucida hardening

ORGANISM(S): Mus Musculus (mouse)

SUBMITTER: Hagen Körschgen

PROVIDER: PXD038561 | JPOST Repository | Fri Sep 15 00:00:00 BST 2023

REPOSITORIES: jPOST

ACCESS DATA

Dataset's files

Source:

Items per page:

1 - 5 of 20

Publications

Substrate profiling of the metalloproteinase ovastacin uncovers specific enzyme-substrate interactions and discloses fertilization-relevant substrates.

Felten Matthias M Distler Ute U von Wiegen Nele N Łącki Mateusz M Behl Christian C Tenzer Stefan S Stöcker Walter W Körschgen Hagen H

The FEBS journal 20230921 1

The metalloproteinase ovastacin is released by the mammalian egg upon fertilization and cleaves a distinct peptide bond in zona pellucida protein 2 (ZP2), a component of the enveloping extracellular matrix. This limited proteolysis causes zona pellucida hardening, abolishes sperm binding, and thereby regulates fertility. Accordingly, this process is tightly controlled by the plasma protein fetuin-B, an endogenous competitive inhibitor. At present, little is known about how the cleavage character ...[more]

PMID: 37690456

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

			Action	DRS
	T140811_02.raw	Raw
	T140811_03.raw	Raw
	T140811_04.raw	Raw
	T140811_05.raw	Raw
	T140811_06.raw	Raw