Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SLC12A3 isoforms in human urine exosomes

ABSTRACT: The thiazide-sensitive NaCl cotransporter (NCC) is an important pharmacological target in the treatment of hypertension. Human SLC12A3 gene encoding NCC gives rise to three isoforms. Only the isoform 3 has been extensively investigated. The goal of the present study was, therefore, to determine the abundance and localization of NCC1 and NCC2 in comparison to NCC3 in the human kidney as well as their functional properties in physiological and pathological conditions. To this end, the presence of NCC1, NCC2, and NCC3 in the human urinary exosomes was assessed by mass spectrometric analysis.

INSTRUMENT(S): Q Exactive

ORGANISM(S): Homo Sapiens (ncbitaxon:9606)

SUBMITTER: Connie Ramona Jimenez

PROVIDER: MSV000080722 | MassIVE | Wed Mar 29 01:02:00 BST 2017

SECONDARY ACCESSION(S): PXD002279

REPOSITORIES: MassIVE

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Publications

Alternative splice variant of the thiazide-sensitive NaCl cotransporter: a novel player in renal salt handling.

Tutakhel Omar A Z OA Jeleń Sabina S Valdez-Flores Marco M Dimke Henrik H Piersma Sander R SR Jimenez Connie R CR Deinum Jaap J Lenders Jacques W JW Hoenderop Joost G J JG Bindels René J M RJ

American journal of physiology. Renal physiology 20151111 3

The thiazide-sensitive NaCl cotransporter (NCC) is an important pharmacological target in the treatment of hypertension. The human SLC12A3 gene, encoding NCC, gives rise to three isoforms. Only the third isoform has been extensively investigated. The aim of the present study was, therefore, to establish the abundance and localization of the almost identical isoforms 1 and 2 (NCC1/2) in the human kidney and to determine their functional properties and regulation in physiological conditions. Immun ...[more]

PMID: 26561651

Similar Datasets

SLC12A3 isoforms in human urine exosomes

Project description:The thiazide-sensitive NaCl cotransporter (NCC) is an important pharmacological target in the treatment of hypertension. Human SLC12A3 gene encoding NCC gives rise to three isoforms. Only the isoform 3 has been extensively investigated. The goal of the present study was, therefore, to determine the abundance and localization of NCC1 and NCC2 in comparison to NCC3 in the human kidney as well as their functional properties in physiological and pathological conditions. To this end, the presence of NCC1, NCC2, and NCC3 in the human urinary exosomes was assessed by mass spectrometric analysis.

2016-06-14 | PXD002279 | Pride

PGC-1 alpha isoforms and muscle hypertrophy

Project description:An alternative promoter of the PGC-1alpha gene gives rise to three new PGC-1alpha isoforms refered to as PGC-1a2 (A2), PGC-1a3 (A3) and PGC-1a4 (A4). The proximal PGC-1 alpha promotor transcribes the canonical PGC-1 alpha which is refered to as PGC-1a1 (A1).G1/G2/G3 samples refer to the Green fluorescent protein (GFP) control samples used in this experiment. Forced expression of the PGC-1a4 isoform results in muslce hypertrophy associated with increased IGF-1 signaling and repression of myostatin signaling.

2012-12-04 | GSE42473 | GEO

Cystic Fibrosis disease Urine exosomes

Project description:Cystic Fibrosis is a life limiting disease due to mutations in the Cystic Fibrosis Conductance Gene Regulator (CFTR). This is associated with a multiorgan disease combining pancreatic insufficiency, chronic infected bronchopathy and production of a salty sweat. Increased survival of patients leads to observation of new complications, including proximal tubule transport dysfunctions with increased output of glucose, amino acids, phosphate, calcium, uric acid, and low Molecular Weight proteins, which ultimately triggers tubulo-interstitial injury and chronic kidney disease. (Jouret et al. 2007) Exosomes are membrane vesicles stemming from Multi-Vesicular Bodies. They reflect the biological state of the cell they stem from because they incorporate various bioactive molecules from their cell of origin, which can be transferred to target cells. They are therefore ideal biomarkers for early diagnosis, prediction of disease progression or response to treatment. Urinary exosomes have been largely investigated in kidney or urothelial diseases and exosomal proteins proved to be biomarkers reflecting renal cellular biology. We hypothetized that urinary exosomal proteins might be differentially expressed, according to the presence of the mutation in the CFTR gene and its correction. We analyzed urinary exosomes of patients with CF and healthy controls based on their protein content determined by high resolution mass spectrometry, in combination with Gene Set Enrichment Analysis. These results were compared to those obtained in exosomes collected in patients treated with CFTR modulators.

2021-03-29 | PXD018537 | Pride

Generation of intestinal organoids from human urine cells

Project description:Intestinal organoids are ideal models for studying human intestinal diseases. We report functional intestinal organoid models (U-iIOs) generated by reprogramming human urinary epithelial cells (hUCs). RNA-seq reveals the intestinal lineage identity of U-iIOs.

2024-07-07 | GSE230718 | GEO

PGC-1 alpha isoforms and muscle hypertrophy

Project description:An alternative promoter of the PGC-1 alpha gene gives arrise to 3 new isofroms of the PGC-1 alpha gene refered to as PGC-1a2 (A2), PGC-1a3 (A3) and PGC-1a4 (A4). The proximal PGC-1 alpha promotor transcribes the canonical PGC-1 alpha which is refered to as PGC-1a1 (A1).G1/G2/G3 samples refer to the Green fluorescent protein (GFP) control samples used in this experiment. Forced expression of specifically PGC-1a4 isoform results in muslce hypertrophy associated with increased IGF-1 signaling and repression of myostatin signaling. Adnoviral over expression assays were performed on primary myoblasts from C57BL/6 mice for each of the PGC-1 alpha isoforms originating from the proximal or alternative promotor.

2012-12-04 | E-GEOD-42473 | biostudies-arrayexpress

BCG urine

Project description:Urinary microbiome according to intravesical BCG treatment

| PRJEB72901 | ENA

urine metagenome

Project description:Urinary microbiota of children with nocturnal enuresis

| PRJDB11881 | ENA

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Expression profiling of cyclin D1 splice variants cyclin D1a and D1b in mouse 3T3 cells.

Project description:Cyclin D1 is an important cell cycle regulator but in cancer its overexpression also increases cellular migration mediated by p27KIP1 stabilization and RhoA inhibition. Recently, a common polymorphism at the exon 4-intron 4 boundary of the human cyclin D1 gene within a splice donor region was associated with an altered risk of developing cancer. Altered RNA splicing caused by this polymorphism gives rise to a variant cyclin D1 isoform termed cyclin D1b, which has the same N-terminus as the canonical cyclin D1a isoform but a distinct C-terminus. Analysis was performed of mouse cyclin D1 knockout 3T3 cells infected with splice variants of cyclin D1. 3T3 cells transduced with retroviral vectors expressing each cyclin D1 isoform were processed for expression analysis. Keywords: Cancer associated risk factor

2008-01-07 | GSE9161 | GEO

Differential miRNA expression profiling of urinary exosomes from normo- and microalbuminuric type 1 diabetic patients

Project description:The aim of this study was to compare miRNA expression in urinary exosomes from type 1 diabetic patients with and without incipient diabetic nephropathy. Overnight urine collections were obtained from normo- and microalbuminuric type 1 diabetic patients. Urines were pre-cleared by both centrifugation and filtration, urinary exosomes were isolated by two consecutive ultracentrifugation steps and total RNA extracted. Differential miRNA profiling was performed using a Human TaqMan miRNA Array A on an 7900HT Fast Real-Time PCR System. Results showed that expression of 22 urinary exosomal miRNAs differed in incipient diabetic nephropathy. Differential qPCR miRNA profiling was performed on urinary exosomes from 2 pairs of micro/normoalbuminuric type 1 diabetic patients comparable for age, sex, diabetes duration, and tightly matched for HbA1c (1° pair: 8.1 vs. 8.1, 2° pair: 8.7 vs. 8.7). MiRNAs were considered differentially expressed if they exhibited greater than twofold expression differences in both pairs.

2014-02-14 | E-GEOD-48318 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data