U2OS Cas9
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB21263 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Saturation guide RNA loading overcomes Cas9-induced human cell death
| PRJEB21268 | ENA
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:In this study we examined the effects of loss of the MYST histone acetyltransferase TIP60 (KAT5) in mouse embryonic fibroblasts (MEFs), human embryonic kidney cells 293 (HEK293), and human osteosarcoma cells (U2OS) on cell proliferation, BrdU incorporation, cell cycle progression, apoptotic and other forms of cell death, DNA damage, histone acetylation at specific lysine residues and RNA expression levels. This dataset relates to U2OS cells. To assess the effects of loss of TIP60 on RNA levels, RNA-seq was performed on U2OS cells, where the TIP60 gene was mutated by CRISPR/Cas9 technology using single guide RNA #1 (g1/C9), single guide RNA #2 (g2/C9), or guide-only controls (g1 or g2). The expression of the guide RNA was induced with doxycycline treatment for 4 days to induce TIP60 gene mutation in the samples also expressing the Cas9 enzyme.
2022-07-22 | GSE208382 | GEO
Project description:CRISPR-Cas9 expression independent of its cognate synthetic guide RNA (gRNA) causes widespread genomic DNA damage in human cells. To investigate whether Cas9 can interact with endogenous human RNA transcripts independent of its guide, we perform eCLIP (enhanced CLIP) of Cas9 in human cells and find that Cas9 reproducibly interacts with hundreds of endogenous human RNA transcripts. This association can be partially explained by a model built on gRNA secondary structure and sequence. Critically, transcriptome-wide Cas9 binding sites do not appear to correlate with published genome-wide Cas9 DNA binding or cut-site loci under gRNA co-expression. However, even under gRNA co-expression low-affinity Cas9-human RNA interactions (which we term CRISPR crosstalk) do correlate with published elevated transcriptome-wide RNA editing. Our findings do not support the hypothesis that human RNAs can broadly guide Cas9 to bind and cleave human genomic DNA, but they illustrate a clear cellular RNA impact likely inherent to CRISPR-Cas systems.
2022-01-24 | GSE167466 | GEO
Project description:Synthetic transcription factors can be applied in many areas of biotechnology, medicine, and basic research. In contrast to current methods based on engineering new DNA-binding proteins, we show that Cas9 fused to a transcriptional activation domain can be targeted by combinations of guide RNA molecules to induce the expression of endogenous human genes. This simple approach for targeted gene activation circumvents the need for engineering new proteins and will enable widespread synthetic gene regulation. HEK293T cells were transfected with plasmid expressing Cas9-VP64 fusion protein and a guide RNA. As a control, empty guide RNA was transfected. Gene expression was then measured using mRNA-seq, and differential expression calculated using DESeq. All experiments were performed in biological duplicates or triplicates.
2013-07-25 | E-GEOD-47114 | biostudies-arrayexpress
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage. ChIP-seq of HA-dCas9 loaded with 4 sgRNAs (Phc1-sg1, Phc1-sg2, Nanog-sg2, and Nanog-sg3) in mouse, and 2 sgRNAs in human (EMX1-sg1 and EMX1-sg3)
2014-04-20 | E-GEOD-54745 | biostudies-arrayexpress
Project description:The CRISPR-Cas9 system enables efficient sequence-specific mutagenesis for creating germline mutants of model organisms. Key constraints in vivo remain the expression and delivery of active Cas9-guideRNA ribonucleoprotein complexes (RNPs) with minimal toxicity, variable mutagenesis efficiencies depending on targeting sequence, and high mutation mosaicism. Here, we established in vitro-assembled, fluorescent Cas9-sgRNA RNPs in stabilizing salt solution to achieve maximal mutagenesis efficiency in zebrafish embryos. Sequence analysis of targeted loci in individual embryos reveals highly efficient bi-allelic mutagenesis that reaches saturation at several tested gene loci. Such virtually complete mutagenesis reveals preliminary loss-of-function phenotypes for candidate genes in somatic mutant embryos for subsequent generation of stable germline mutants. We further show efficient targeting of functional non-coding elements in gene-regulatory regions using saturating mutagenesis towards uncovering functional control elements in transgenic reporters and endogenous genes. Our results suggest that in vitro assembled, fluorescent Cas9-sgRNA RNPs provide a rapid reverse-genetics tool for direct and scalable loss-of-function studies beyond zebrafish applications.
2016-05-01 | E-MTAB-4143 | biostudies-arrayexpress
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:CRISPR screen: U2OS or U2OS p53KO cells expressing Cas9 were transduced with a whole-genome library of CRISPR sgRNAs, then treated with either DMSO or etoposide. Differential sgRNA abundances were calculated for each condition and used to determine the effect of each single gene knockout on fitness and the drug-induced death rate. RNA-Seq: U2OS or U2OS p53KO cells were cultured with either DMSO or etoposide for 48 hours, and then U2OS cells were incubated in this conditioned media for 8 hours. RNA was collected and use to observe differential expression changes between conditions.
2023-05-17 | GSE232592 | GEO