Ontology highlight
ABSTRACT:
PROVIDER: PRJNA438963 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Sequence Capture using PCR-generated Probes
| PRJNA239759 | ENA
Project description:HPV integrated site capture (HISC) protocol used to detect HPV16 integration breakpoints in the genomes of W12 cell lines. Biotinylated HPV16-specific RNA baits were used to capture HPV16-human breakpoint junctions in genomic DNA.
2021-06-18 | E-MTAB-10154 | biostudies-arrayexpress
Project description:We have performed circular chromosome conformation capture sequencing (4C-seq) with six baits located at the Runx1 locus in the mouse hematopoietic progenitor cell line HPC-7. 4C baits were designed to the P1 and P2 promoters and to the previously characterised +24 hematopoietic enhancer (P1, P2 and 24), with secondary baits located at nearby cohesin/CTCF (cc) binding sites (P1cc, 24cc, P2cc).
2017-10-22 | GSE86994 | GEO
Project description:We provide raw gene sequences of 174 flowering time regulatory genes and gene othologs across a large barley population (895 barley lines) selected from a collection of landrace, cultivated barley, and research varieties of diverse origin. This set represents the whole variety of cultivated barley lifeforms, namely two- and six-row genotypes with winter, spring, and facultative growth habits. We applied a target capture method based on in-solution hybridization using the myBaits® technology (Arbor Biosciences, Ann Arbour, MI, USA) which is based on in-solution biotinylated RNA probes. Baits were designed for flowering time regulatory genes and gene othologs, and used for production of 80mer capture oligonucleotides for hybridization. Genomic DNA was extracted from leaves of a single two-week old barley plant per variety using the cetyl-trimethyl-ammonium bromide (CTAB) method. Physical shearing of genomic DNA was performed with an average size of 275 bp. Library preparation was conducted with KAPA Hyper Prep Kit (KAPA Biosystems, Wilmington, MA). Hybridization of customised RNA baits with capture pools was performed at 65°C for 24 hours. Each pooled sequence capture library was sequenced on an Illumina HiSeq3000 instrument using three lanes to generate paired-end reads per sample. Genome sequencing was conducted at AgriBio, (Centre for AgriBioscience, Bundoora, VIC, Australia).
2019-02-15 | E-MTAB-7362 | biostudies-arrayexpress
Project description:Two biological replicates Hi-C and HPV16-specific Region Capture Hi-C libraries were prepared for each of the W12 cell lines. Capture Hi-C was performed using HPV16-specific RNA baits. Hi-C libraries alone were prepared from normal cervix tissue (Ncx).
2021-06-18 | E-MTAB-10152 | biostudies-arrayexpress
Project description:We applied the solution hybrid selection approach to the enrichment of CpG islands (CGIs) and promoter sequences from the human genome for targeted high-throughput bisulfite sequencing. A single lane of Illumina sequences allowed accurate and quantitative analysis of 1 million CpGs in more than 21,408 CGIs and 15,946 transcriptional regulatory regions. More than 85% of capture probes successfully yielded quantitative DNA methylation information of targeted regions. In this study, we generated genome-wide, single-base resolution DNA methylation maps in three of the most commonly used breast cancer cell lines.Differentially methylated regions (DMRs) were identified in the 5?-end regulatory regions, as well as the intra- and intergenic regions, particularly in the X chromosome among the three cell lines. The single CpG resolution methylation maps of many known tumor suppressor genes were also established in the three cell lines. Here we present a novel approach that combines solution-phase hybrid selection and massively parallel bisulfite sequencing to profile DNA methylation in targeted CGI and promoter regions. We designed 51,466 single strand DNA oligonucleotides (160-mer) which target 23,441 CGIs and the transcription start sites of 19,369 known genes in the human genome. The synthetic long DNA oligonucleotides were converted into biotinylated RNA probes for solution-phase hybridization capture of target DNA. The captured genomic DNA was treated with sodium bisulfite, amplified by PCR and sequenced using Illumina GA IIx sequencer.
2011-08-01 | E-GEOD-26826 | biostudies-arrayexpress
Project description:The goals of this study were to identify novel proteins involved in barley immune responses. Yeast-two-hybrid (Y2H) screening was coupled with next-generation sequencing to identify and quantify interacting proteins. Y2H baits consisted of Blumeria graminis effector proteins and different domains of the barley MLA6 powdery mildew resistance protein. These baits were mated to a cDNA prey library derived from a 0-48 hour time course of infected leaf tissue. Screens were performed in batch liquid culture to enrich yeast populations for cells expressing positive interactions. After two rounds of enrichment under selective (Histidine absent) and non-selective (Histidine present) conditions, yeast cells were collected. Y2H plasmids were extracted and prey cDNA amplicons were generated via low-cycle PCR. Fragmented amplicons were used as input to generate sequencing libraries and processed on the HiSeq 3000 platform. Reads were mapped to the barley and Blumeria graminis genomes and read counts were analyzed using a custom data processing and scoring pipeline. Putative interactors were cloned and binary Y2H was used to confirm interactions. We demonstrate a high rate of confirmations for top-ranked candidates. Altogether, this study establishes a high-throughput method for protein-protein interaction discovery in non-model organisms where ORF libraries are not available.
2021-05-13 | GSE150396 | GEO
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:One tooth of a lamprey and one piece of trunc skin was lysed and analysed for its protein content. The samples were generously provided by the Museum of Natural History Vienna. The samples were stored in ethanol and the origin of the specimen is not known.
2024-05-21 | PXD048873 | Pride