Ontology highlight
ABSTRACT:
PROVIDER: PRJNA615771 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR11431286.fastq.gz | Fastqsanger.gz | |||
| SRR11431286_1.fastq.gz | Fastqsanger.gz | |||
| SRR11431286_2.fastq.gz | Fastqsanger.gz | |||
| SRR11431287.fastq.gz | Fastqsanger.gz | |||
| SRR11431287_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:This dataset contains ChIP-seq data of H3K4me3 and Pol III in single cell-derived control and CRISPR/Cas9 induced tRNA gene deletion clones in human cancer cell lines HAP1 and HepG2. In this study, we looked into functional Cas9-induced on-target genomic alteration in our tRNA gene deletion clones, HAP1 t72 and HepG2 t15.
2022-09-16 | E-MTAB-10651 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:Human acute myeloid leukemia cell lines OCI-AML2 and OCI-AML3 were used in a CRISPR/Cas9-mediated approach to specifically target DDX3X’s gene sequences encoding the RNA binding domain of the helicase. DDX3X RNA binding domain is bipartite in the two halves of the helicase core. sgRNAs were designed to target both halves of the domain (named RNA binding domain A and B – RBDA and RBDB). We performed RNA-seq to observe the gene expression changes in both OCI-AML2 and OCI-AML3 cell lines following the not-combined CRISPR/Cas9 –mediated targeting of both regions of the DDX3X RNA binding domain. Control CRISPR/Cas9 performed with no sgRNA expressing vector (named “empty vector”) was performed in both cell lines. The latter condition was used as a control for gene expression changes analysis, for each cell line.
2019-11-23 | E-MTAB-6241 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:We sought to characterise how chromatin states affected CRISPR/Cas9 activity and the induced indel profiles. We used two different doses of Trichostatin and two different doses of a EZH2 inhibitor to modulate the chromatin state and then performed targeted DNA-seq of selected sgRNA target regions to identify the indels.
2018-12-13 | E-MTAB-7091 | biostudies-arrayexpress
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-06-15 | GSE149295 | GEO
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-09-22 | GSE149361 | GEO
Project description:Adenosine base editing to recreate the HPFH mutations is a promising approach to induce HbF. We used CIRCLE-seq to identify 682 potential off-target sites in purified DNA treated with Cas9 nuclease complexed to sgRNA targeting -globin -175 .
2023-04-28 | GSE228569 | GEO