Ontology highlight
ABSTRACT:
PROVIDER: PRJNA752141 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR15359218_1.fastq.gz | Fastqsanger.gz | |||
| SRR15359218_2.fastq.gz | Fastqsanger.gz | |||
| SRR15359219_1.fastq.gz | Fastqsanger.gz | |||
| SRR15359219_2.fastq.gz | Fastqsanger.gz | |||
| SRR15359220_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 40 |
Similar Datasets
Project description:Translational research on the Cre/loxP recombination system focuses on enhancing its specificity by modifying Cre/DNA interactions. Despite extensive efforts, the exact mechanisms governing how Cre distinguishes between substrates remains elusive. Cre recognizes 13 bp inverted repeats, initiating recombination in the 8 bp spacer region. While literature suggests that efficient recombination proceeds between lox sites with non-loxP spacer sequences when both lox sites have matching spacers, experimental validation for this assumption is lacking. To fill this gap, we investigated target site variations of identical pairs of the loxP 8 bp spacer region, screening 6,000 unique loxP-like sequences. Approximately 84% of these sites exhibited efficient recombination, affirming the flexibility of spacer sequences for catalysis. However, certain spacers negatively impacted recombination, emphasizing sequence dependence. Directed evolution of Cre on inefficiently recombined spacers not only yielded recombinases with enhanced activity but also mutants with reprogrammed selective activity. Mutations altering spacer specificity were identified, and molecular modelling and dynamics simulations elucidated the mechanism behind this specificity switch. These findings highlight the potential to fine-tune site-specific recombinases for spacer sequence specificity, offering a novel concept to enhance the applied properties of designer-recombinases for genome engineering applications.
2024-07-25 | GSE254392 | GEO
Project description:Paired-end deep-sequencing was used to determine in parallel the status and position of sister-chromatid contact (SC2) reporters and/or site-specific recombinase (SSR) activity reporters inserted at random positions in a library of cells. The SC2 reporters are short recombination cassettes for a topology-independent site-specific recombinase (Cre or Xer). The SSR-activity reporters are long recombination cassettes. The SC2 reporter cassettes are composed of two directly-repeated recombination sites separated by a DNA segment too short to permit their excision by intramolecular recombination. The SSR-activity cassettes are composed of two directly-repeated recombination sites separated by a DNA segment long enough to permit their excision by intramolecular recombination. The assays start with the engineering of a cell line with a conditional expression allele for Cre or Xer and the creation of a library of cells harbouring a cognate SC2 or SSR-activity reporter at different genomic positions. Production of the recombinase was induced for different lengths of time during cell growth and/or at specific stages of the cell cycle. The position of the SC2 reporter harboured by each cell and the recombination status of the recombination cassette it contains are then determined by high-throughput paired-end sequencing.
2020-07-07 | E-MTAB-8946 | biostudies-arrayexpress
Project description:Genome editing tools with high precision are key to develop improved crops but current technologies to place new DNA into specific locations in plant genomes are low frequency and error-prone. Transposable elements (TEs) evolved to insert their DNA seamlessly into genomes, albeit in a quasi-random pattern. We developed a genome engineering tool that controls the TE insertion site and subsequently the delivery of any cargo attached to this TE. Using our tool, we demonstrated sequence-specific targeted delivery (guided by the CRISPR gRNA) of enhancers, an open reading frame and gene expression cassette into the genome of the model plant Arabidopsis, and we translated this technology to the crop soybean. We have engineered a ‘junk’ TE into a useful and accessible toolkit that enables the sequence-specific targeting of custom DNA into plant genomes.
2024-05-03 | GSE227104 | GEO
Project description:Genome editing tools with high precision are key to develop improved crops but current technologies to place new DNA into specific locations in plant genomes are low frequency and error-prone. Transposable elements (TEs) evolved to insert their DNA seamlessly into genomes, albeit in a quasi-random pattern. We developed a genome engineering tool that controls the TE insertion site and subsequently the delivery of any cargo attached to this TE. Using our tool, we demonstrated sequence-specific targeted delivery (guided by the CRISPR gRNA) of enhancers, an open reading frame and gene expression cassette into the genome of the model plant Arabidopsis, and we translated this technology to the crop soybean. We have engineered a ‘junk’ TE into a useful and accessible toolkit that enables the sequence-specific targeting of custom DNA into plant genomes.
2024-05-03 | GSE227103 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114858 | GEO
Project description:The development of CRISPR-Cas systems for targeting DNA and RNA in diverse organisms has transformed biotechnology and biological research. Moreover, the CRISPR revolution has highlighted bacterial adaptive immune systems as a rich and largely unexplored frontier for discovery of new genome engineering technologies. In particular, the class 2 CRISPR-Cas systems, which use single RNA-guided DNA-targeting nucleases such as Cas9, have been widely applied for targeting DNA sequences in eukaryotic genomes. Here, we report DNA-targeting and transcriptional control with class I CRISPR-Cas systems. Specifically, we repurpose the effector complex from type I variants of class 1 CRISPR-Cas systems, the most prevalent CRISPR loci in nature, that target DNA via a multi-component RNA-guided complex termed Cascade. We validate Cascade expression, complex formation, and nuclear localization in human cells and demonstrate programmable CRISPR RNA (crRNA)-mediated targeting of specific loci in the human genome. By tethering transactivation domains to Cascade, we modulate the expression of targeted chromosomal genes in both human cells and plants. This study expands the toolbox for engineering eukaryotic genomes and establishes Cascade as a novel CRISPR-based technology for targeted eukaryotic gene regulation.
2019-06-26 | GSE114857 | GEO
Project description:Enzymatic methylation of cytosine to 5-methylcytosine in DNA is a fundamental epigenetic mechanism involved in mammalian development and disease. DNA methylation is brought about by collective action of three AdoMet-dependent DNA methyltransferases (DNMTs), whose catalytic interactions and temporal interplay are poorly understood. We used structure-guided engineering of the Dnmt1 methyltransferase to enable catalytic transfer of azide tags onto DNA from a synthetic cofactor analog, Ado-6-azide, in vitro . We then CRISPR-edited the Dnmt1 locus in mouse embryonic stem cells to install the engineered codon, which, following pulse- internalization of the Ado-6-azide cofactor by electroporation, permitted selective azide-tagging of Dnmt1-specific genomic targets in cellula . The deposited covalent tags were exploited as ‘click’ handles for reading adjoining sequences and precise genomic mapping of the methylation sites. The proposed approach, Dnmt-TOP-seq, enables high-resolution temporal tracking of the Dnmt1 catalysis in mammalian cells paving the way to selective studies of other methylation pathways in eukaryotic systems.
2022-02-04 | GSE182445 | GEO
Project description:Promoters play a central role in controlling gene regulation; however, a small set of promoters is used for most genetic construct design in the yeast Saccharomyces cerevisiae. The ability to generate and utilize models that accurately predict protein expression from promoter sequence may enable rapid generation of novel useful promoters, facilitating synthetic biology efforts in this model organism. We measured the activity of over 675,000 unique sequences in a constitutive promoter library, and over 327,000 sequences in a library of inducible promoters. Training an ensemble of convolutional neural networks jointly on the two datasets enabled very high (R2 > 0.79) predictive accuracies on multiple prediction tasks. We developed model-guided design strategies which yielded large, sequence-diverse sets of novel promoters exhibiting activities similar to current best-in-class sequences. In addition to providing large sets of new promoters, our results show the value of model-guided design as an approach for generating DNA parts.
2019-12-01 | GSE135464 | GEO
Project description:Insertion sequences (IS) are compact and pervasive transposable elements found in bacteria, which encode only the genes necessary for their mobilization and maintenance. IS200/IS605 elements undergo ‘peel-and-paste’ transposition catalyzed by a TnpA transposase, but intriguingly, they also encode diverse, TnpB-family genes that are evolutionarily related to the CRISPR-associated effectors Cas9 and Cas12. Recent studies demonstrated that TnpB-family enzymes function as RNA-guided DNA endonucleases, but the broader biological role of this activity has remained enigmatic. Here we show that IscB and TnpB are essential to prevent loss of the donor IS element and potential transposon extinction as a consequence of the TnpA transposition mechanism. We first performed phylogenetic analysis of IscB/TnpB proteins and selected a family of related IS elements from Geobacillus stearothermophilus that we predicted would be mobilized by a common TnpA homolog. After reconstituting transposition using a heterologous expression system in E. coli, we found that IS elements were readily lost from the donor site due to the activity of TnpA in rejoining the flanking sequences back together upon excision. However, these IS elements also encode non-coding RNAs that guide TnpB and IscB nucleases to precisely recognize and cleave these excision products, leading either to elimination of the excision product or re-installation of the transposon through recombination. Indeed, under experimental conditions in which TnpA and TnpB-RNA complexes were co-expressed together with a genomically integrated IS element, transposon retention was significantly increased relative to conditions expressing TnpA alone. Remarkably, both TnpA and TnpB recognize the same AT-rich transposon-adjacent motif (TAM) during transposon excision and RNA-guided DNA cleavage, respectively, revealing a striking convergence in the evolution of DNA sequence specificity between transposase and nuclease. Collectively, our study reveals that RNA-guided DNA cleavage is a primal biochemical activity that arose to bias the selfish inheritance of transposable elements, which was later co-opted during the evolution of CRISPR-Cas adaptive immunity for antiviral defense.
2023-06-01 | GSE223127 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress