Defining the Caprin-1 interactome in unstressed and stressed conditions
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Orbitrap Fusion Lumos
ORGANISM(S): Homo Sapiens (human)
TISSUE(S): Permanent Cell Line Cell, Cell Culture
SUBMITTER: 
Krystine Mansfield
LAB HEAD: Patrick Pirrotte
PROVIDER: PXD023271 | Pride | 2021-05-07
REPOSITORIES: Pride
Dataset's files
Items per page: 5 1 - 5 of 120 |
Publications
Defining the Caprin-1 Interactome in Unstressed and Stressed Conditions.
Vu Lucas L Ghosh Asmita A Tran Chelsea C Tebung Walters Aji WA Sidibé Hadjara H Garcia-Mansfield Krystine K David-Dirgo Victoria V Sharma Ritin R Pirrotte Patrick P Bowser Robert R Vande Velde Christine C
Journal of proteome research 20210503 6
Cytoplasmic stress granules (SGs) are dynamic foci containing translationally arrested mRNA and RNA-binding proteins (RBPs) that form in response to a variety of cellular stressors. It has been debated that SGs may evolve into cytoplasmic inclusions observed in many neurodegenerative diseases. Recent studies have examined the SG proteome by interrogating the interactome of G3BP1. However, it is widely accepted that multiple baits are required to capture the full SG proteome. To gain further insi ...[more]
Similar Datasets
Project description:This study aims at addressing soybean seeds (variety Absolute RR) germination, at 48h, during optimal and salt stressed condition when treated with bacterial signal compounds lipo-chitooligosaccharide (LCO) and thuricin 17 (Th17). Soybean growth is negatively affected when exposed to 40 mM NaCl and exposure to 80 mM NaCl is often lethal. When treated with the bacterial signal compounds lipo-chitooligosaccharide (LCO) and thuricin 17 (Th17), soybean seeds (variety Absolute RR) responded positively at salt stress of up to 150 mM NaCl. Shotgun proteomics of unstressed and 100 mM NaCl stressed seeds (48 h) in combination with the LCO and Th17 revealed many known, predicted, hypothetical and unknown proteins. In all, carbon, nitrogen and energy metabolic pathways were affected under both unstressed and salt stressed conditions when treated with signals. PEP carboxylase, Rubisco oxygenase large subunit, pyruvate kinase, and isocitrate lyase were some of the noteworthy proteins enhanced by the signals, along with antioxidant glutathione-S-transferase and other stress related proteins. These findings suggest that the germinating seeds alter their proteome based on bacterial signals and on stress, the specificity of this response plays a crucial role in organ maturation and transition from one stage to another in the plants life cycle; understanding this response is of fundamental importance in agriculture and, as a result, global food security.
2016-09-12 | PXD004106 | Pride
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Lipo-chitooligosaccharide (LCO) and thuricin 17 (Th17) are two bacterial compounds that have been shown to positively influence plant growth of both legumes and non-legumes. Arabidopsis thaliana responded positively to treatment with the bacterial signal compounds LCO and Th17 in the presence of salt stress (up to 250 mM NaCl). Shotgun proteomics of unstressed and 250 mM NaCl stressed A. thaliana rosettes (7 days post stress) in combination with the LCO and Th17 revealed many known, putative, hypothetical and unknown proteins. Overall, carbon and energy metabolic pathways were affected under both unstressed and salt stressed conditions when treated with these signals. PEP carboxylase, Rubisco-oxygenase large subunit, pyruvate kinase, and proteins of photosystem I and II were some of the noteworthy proteins enhanced by the signals, along with other stress related proteins. These findings suggest that the proteome of A. thaliana rosettes is altered by the bacterial signals tested, and more so under salt stress, thereby imparting a positive effect on plant growth under high salt stress. The roles of the identified proteins are discussed here in relation to salt stress adaptation, which, when translated to field grown crops can be a crucial component and of significant importance in agriculture and global food production.
2016-09-29 | PXD004742 | Pride
Project description:Binding of transcription factors (TFs) to regulatory sequences is a pivotal step in the control of gene expression. Despite many advances in the characterization of sequence motifs recognized by TFs, our ability to quantitatively predict TF binding to different regulatory sequences is still limited. Here, we present a novel experimental assay termed BunDLE-seq that provides quantitative measurements of TF binding to thousands of fully designed sequences of 200 bp in length within a single experiment. Applying this binding assay to two yeast TFs we demonstrate that sequences outside the core TF binding site profoundly affect TF binding. We show that TF-specific models based on the sequence or DNA shape of the regions flanking the core binding site are highly predictive of the measured differential TF binding. We further characterize the dependence of TF binding, accounting for measurements of single and co-occurring binding events, on the number and location of binding sites and on the TF concentration. Finally, by coupling our in vitro TF binding measurements, and another application of our method probing nucleosome formation, to in vivo expression measurements carried out with the same template sequences now serving and promoters, we offer insights into mechanisms that may determine the different expression outcomes observed. Our assay thus paves the way to a more comprehensive understanding of TF binding to regulatory sequences, and allows the characterization of TF binding determinants within and outside of core binding sites. Binding experiments were carried out with one of two input libraries; Lib1 (also referred to as “main lib”) includes designed sequence variants of length 150bp, and Lib2 (also referred to as “constant flanks lib”) includes designed sequence variants of length 200bp. The sequences of the variants of interest can be found in the second column of the processed data file (BunDLE-seq_data, see 3 excel sheets). EXP1, EXP2 and EXP3 were carried out using Lib1, and EXP4 was carried out using Lib2. Binding experiments were carried out with different proteins (in different concentrations) – DNA was extracted from bound bands that were formed on the gel and amplified with a primer with a unique 5bp upstream tail specifying the identity of the originating band (also referred to as “band barcode”). Data from the following bands was used in the analysis: EXP1_band1, no-protein band – with band barcode “AACGA”, EXP1_band2, single Gcn4 (conc 1:8) bound band* – with band barcode “TCGTA” , EXP1_band3, histones bound band – with band barcode “AGATA”, EXP2_band1, no-protein band – with band barcode “AACGA”, EXP2_band2, single Gcn4 (conc 1:8) bound band* – with band barcode “AGATA”, EXP2_band2, single Gcn4 (conc 1:7) bound band – with band barcode “CACTT”, EXP2_band2, single Gcn4 (conc 1:6) bound band – with band barcode “TCGTA”, EXP2_band2, single Gcn4 (conc 1:5) bound band – with band barcode “CATCA”, EXP2_band2, single Gcn4 (conc 1:4) bound band – with band barcode “TATTA”, EXP2_band2, single Gcn4 (conc 1:3) bound band – with band barcode “AGTCA”, EXP2_band2, single Gcn4 (conc 1:2) bound band – with band barcode “ACGAA”, EXP2_band2, single Gcn4 (conc 1:1) bound band – with band barcode “ACAGA”, EXP2_band2, two Gcn4 (conc 1:1) bound band – barcoded with “GTAGA”, EXP3_band1, no-protein band – with band barcode “GCATA”, EXP3_band2, single Gal4 (conc 1:1) bound band – with band barcode “GATGT”, EXP3_band3, single Gal4 (conc 3:1) bound band – with band barcode “GTTCA”, EXP3_band4, two Gal4 (conc 3:1) bound band – with band barcode “CTCAA”, EXP4_band1, no-protein band – with band barcode “GAGTA”, EXP4_band2, single Gcn4 (conc 1:3) bound band – “TACCA”, EXP4_band3, no-protein band – with band barcode “TCGTT”, EXP4_band3, single Gal4 (conc 3:1) bound band – with band barcode “ACATC”, *biological replicates
2015-03-04 | E-GEOD-66143 | biostudies-arrayexpress
Project description:The sensibility of the used low-density arrays was tested by applying the lab strain S. cerevisiae H155. Important abiotic parameters were tested as they were introduced as elevated osmotic, pH or ethanol stress to the cells. Results from one loop including samples from cells in five different conditions are summarized in this study. Microarrays were hybridized in a loop approach.
2013-10-02 | E-GEOD-45948 | biostudies-arrayexpress
Project description:Environmental stresses that disrupt protein homeostasis induce phosphorylation of eIF2, triggering repression of global protein synthesis coincident with preferential translation of ATF4, a transcriptional activator of the Integrated stress response (ISR). Depending on the extent of protein disruption, ATF4 may not be able to restore proteostatic control and instead switch to a terminal outcome that features elevated expression of the transcription factor CHOP (GADD153/DDIT3). The focus of this study was to define the mechanisms by which CHOP directs gene regulatory networks that determine cell fate. We find that in response to proteasome inhibition, CHOP induces the expression of a collection of genes encoding transcription regulators, including ATF5, which is preferentially translated during eIF2 phosphorylation. Transcriptional expression of ATF5 is directly activated by both CHOP and ATF4. Knock-down of ATF5 increased cell survival in response to proteasome inhibition, supporting the idea that both ATF5 and CHOP have pro-apoptotic functions. Transcriptome analyses of ATF5-dependent genes revealed targets involved in apoptosis, including, NOXA, which is important for inducing cell death during proteasome inhibition. This study suggests that the ISR features a feed-forward loop of stress induced transcriptional regulators, each subject to transcriptional and translational control that can switch cell fate towards apoptosis. 8 plates (10cm) of WT and and 8 plates (10cm) of ATF5-KD MEF cells were subject to no stress (4 each for a total of 8) or treated for 8 hours with 1uM MG132 (4 each for a total of 8). Unstressed cells were harvested at the same time as the stressed cells
2013-09-05 | E-GEOD-43714 | biostudies-arrayexpress
Project description:Environmental stresses that disrupt protein homeostasis induce phosphorylation of eIF2, triggering repression of global protein synthesis coincident with preferential translation of ATF4, a transcriptional activator of the Integrated stress response (ISR). Depending on the extent of protein disruption, ATF4 may not be able to restore proteostatic control and instead switch to a terminal outcome that features elevated expression of the transcription factor CHOP (GADD153/DDIT3). The focus of this study was to define the mechanisms by which CHOP directs gene regulatory networks that determine cell fate. We find that in response to proteasome inhibition, CHOP induces the expression of a collection of genes encoding transcription regulators, including ATF5, which is preferentially translated during eIF2 phosphorylation. Transcriptional expression of ATF5 is directly activated by both CHOP and ATF4. Knock-down of ATF5 increased cell survival in response to proteasome inhibition, supporting the idea that both ATF5 and CHOP have pro-apoptotic functions. Transcriptome analyses of ATF5-dependent genes revealed targets involved in apoptosis, including, NOXA, which is important for inducing cell death during proteasome inhibition. This study suggests that the ISR features a feed-forward loop of stress induced transcriptional regulators, each subject to transcriptional and translational control that can switch cell fate towards apoptosis. 8 plates (10cm) of WT and and 8 plates (10cm) of CHOP-/- MEF cells were subject to no stress (4 each for a total of 8) or treated for 8 hours with 1uM MG132 (4 each for a total of 8). Unstressed cells were harvested at the same time as the stressed cells
2013-09-05 | E-GEOD-43713 | biostudies-arrayexpress
Project description:In contrast to the general ubiquitin activation and transfer cascade, we show that Uba1 binds to ubiquitin conjugating enzymes (Ubc) even in the absence of ubiquitin under mild oxidizing conditions. We show that this binding is ATP-dependent and leads to a disulfide-linkage between the catalytic cysteine residues as demonstrated with gel shift assays and visualized in a high-resolution structure of a covalent Uba1Ubc13 complex. The structure provides additional insights into the Uba1-Ubc binding mode and reveals unexpected structural changes in the N-terminus of Uba1, leading to a more open ATP-binding pocket. Immunoprecipitation experiments with yeast cells in combination with mass spectrometry revealed that several Uba~Ubc complexes are generated in vivo under oxidative stress conditions.
2017-04-11 | PXD005588 | Pride
Project description:Microarray profiling single and repeated immobilization stress responses in gene expression in rat adrenal medulla Experiment Overall Design: Immobilization stress (IMO) was performed with 2-hour once and 2-hour daily for 6 days repeated. Control groups were not exposed to stress (absolute controls). Following the last IMO, rats were euthanized by decapitation and both adrenal medulla tissues were dissected from the animal. Total RNA were isolated and the array experiments were done by Affymetrix. Data analysis will be performed by GeneTraffic program.
2008-10-18 | E-GEOD-8184 | biostudies-arrayexpress
Project description:I-Traq based quantitative phosphoproteomics was used to examine changes in phosphopeptide abundance over longer term drought (low water potential) treatments. Samples were analyzed from unstressed seedlings grown on agar plates and from seedlings of the same age that had been transferred to low water potential (-1.2 MPa) for 96 h on PEG-infused agar plates. The genotypes analyzed were wild type Col-0 and two phosphatases mutants. One was a double mutant of two Clade E protein phosphatase 2Cs (Salk_011589 which lacks activity of AT3G05640 and Salk_048861 which lacks activity of AT5G27930). The other was a mutant (hai1-2) of the Clade A protein phosphatase 2C Highly ABA-Induced 1 (HAI1): Salk_108282 which lacks activity of AT5G59220). Our characterization of hai1-2 as well as detailed description of growth conditions and stress treatments has been reported in Bhaskara et al. (Plant Physiology 160:379-395, 2012). Characterization of the Clade E protein phosphatase 2Cs have not been previously reported and we have designated these as Clade E Growth Regulating PP2Cs (EGRs) based on characterization in our laboratory. The double mutant used for phosphoproteomic analysis has been designated egr1-1egr2-1. Three biological replicates were performed and microarray analysis of gene expression was performed on samples collected from the same experiments. The gene expression data sets have been deposited in Gene Expression Onmibus (GEO) under accession numbers GSE35258 (hai1-2 data) and GSE71237 (egr1-1egr2-1 data).
2017-01-17 | PXD004869 | Pride