Dataset Information

Sequence and structural Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligase

ABSTRACT: The BTB-Kelch protein KLHL3 is a Cullin3-dependent E3 ligase that mediates the ubiquitin-dependent degradation of kinases WNK1-4 to control blood pressure and cell volume. A crystal structure of KLHL3 has defined its binding to an acidic degron motif containing a PXXP sequence that is strictly conserved in WNK1, WNK2 and WNK4. Mutations in the second proline abrograte the interaction causing the hypertension syndrome pseudohypoaldosteronism type II. WNK3 shows a diverged degron motif containing 4 amino acid substitutions that remove the PXXP motif raising questions as to the mechanism of its binding. To understand this atypical interaction, we determined the crystal structure of the KLHL3 Kelch domain in complex with a WNK3 peptide. The electron density enabled the complete 11-mer WNK-family degron motif to be traced for the first time revealing several conserved features not captured in previous work, including additional salt bridge and hydrogen bond interactions. Overall, the WNK3 peptide adopted a conserved binding pose except for a subtle shift to accommodate bulkier amino acid substitutions at the binding interface. At the centre, the second proline was substituted by WNK3 Thr541, providing a unique phosphorylatable residue among the WNK-family degrons. Fluorescence polarisation and structural modelling experiments revealed that its phosphorylation would abrogate the KLHL3 interaction similarly to hypertension-causing mutations. Together, these data reveal how the KLHL3 Kelch domain can accommodate the binding of multiple WNK isoforms and highlight a potential regulatory mechanism for the recruitment of WNK3.

INSTRUMENT(S): Orbitrap Fusion Lumos

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Early Embryonic Cell, Kidney

SUBMITTER: Roman Fischer

LAB HEAD: Roman Fischer

PROVIDER: PXD031606 | Pride | 2022-03-07

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	FL732_MSQ1213_20180124_ZhuoyaoChen_WNK3_hypo_5ul.mgf	Mgf
	FL732_MSQ1213_20180124_ZhuoyaoChen_WNK3_hypo_5ul.raw	Raw
	FL732_MSQ1213_20180124_ZhuoyaoChen_WNK3_iso_5ul.mgf	Mgf
	FL732_MSQ1213_20180124_ZhuoyaoChen_WNK3_iso_5ul.raw	Raw
	peptides_1_1_0_hypo.mzid.gz	Mzid

Items per page:

1 - 5 of 6

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Sequence and structural Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligase

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets