Dataset Information

Keap1 is an endogenous dCas9 suppressor inhibiting CRISPRa and CRISPRi efficiency

ABSTRACT: As a potent and accurate genome-editing tool, CRISPR-Cas9 has been widely used in biomedical research and evaluated as gene therapy in treating human diseases. Although distinct engineered Cas9s, dCas9s and additional endonucleases have been identified, as these bacterial enzymes do not naturally express in mammalian cells, whether and how bacterial Cas9 proteins are regulated by mammalian hosts remains poorly understood. Here, we identified Keap1 as an endogenous E3 ligase that targets Cas9/dCas9/Fanzor1 for ubiquitination and degradation. Cas9-“ETGE” mutants evading Keap1 recognition displayed enhanced gene editing ability in cells. dCas9-“ETGE” mutants displayed extended protein half-life on chromatin, leading to significantly improved CRISPa and CRISPRi efficacy. Cas9 binding to Keap1 also inactivate Keap1 function via competing with Keap1 substrates or binding partners, while engineered Cas9 mutants showed less perturbation. Thus, our study reveals a mammalian specific Cas9 regulation and provides new Cas9 designs not only with enhanced gene regulatory capacity but also with minimal effects on disrupting endogenous Keap1 signaling.

INSTRUMENT(S): Orbitrap Fusion Lumos

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Permanent Cell Line Cell

SUBMITTER: Dennis Goldfarb

LAB HEAD: Pengda Liu

PROVIDER: PXD050935 | Pride | 2025-01-20

REPOSITORIES: pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	LI001_293T_Flag_EV_Rep1_Siyuan_3ul_2to30.raw	Raw
	LI002_293T_Flag_Cas9_WT_Rep1_Siyuan_3ul_2to30.raw	Raw
	LI003_293T_Flag_Cas9_EAAE_Rep1_Siyuan_3ul_2to30.raw	Raw
	LI004_293T_Flag_EV_Rep2_Siyuan_3ul_2to30.raw	Raw
	LI005_293T_Flag_Cas9_WT_Rep2_Siyuan_3ul_2to30.raw	Raw

Items per page:

1 - 5 of 11

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Keap1 is an endogenous dCas9 suppressor inhibiting CRISPRa and CRISPRi efficiency

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets