Ontology highlight
ABSTRACT:
PROVIDER: PRJEB11818 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| ERR1147180_1.fastq.gz | Fastqsanger.gz | |||
| ERR1147180_2.fastq.gz | Fastqsanger.gz | |||
| ERR1147190.fastq.gz | Fastqsanger.gz | |||
| ERR1147200.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 86 |
Similar Datasets
Project description:Sequencing was performed to assess the ability of Nanopore direct cDNA and native RNA sequencing to characterise human transcriptomes. Total RNA was extracted from either HAP1 or HEK293 cells, and the polyA+ fraction isolated using oligodT dynabeads. Libraries were prepared using Oxford Nanopore Technologies (ONT) kits according to manufacturers instructions. Samples were then sequenced on ONT R9.4 flow cells to generate fast5 raw reads in the ONT MinKNOW software. Fast5 reads were then base-called using the ONT Albacore software to generate Fastq reads.
2019-03-14 | E-MTAB-7778 | biostudies-arrayexpress
Project description:The LRGASP challenge encompasses different human, mouse, and manatee samples sequenced using multiple combinations of protocols and platforms. Different challenges will use distinct subsets of the samples for evaluation. The long-read sequencing platforms used in these challenges are the Pacific Biosciences (PacBio) Sequel II, Oxford Nanopore (ONT) MinION and PromethION. Samples will also be sequenced on the Illumina HiSeq 2500. The primary LRGASP library prep protocols are “standard” cDNA sequencing, direct RNA sequencing, R2C2, and CapTrap. Each sample will also include Lexogen SIRV-Set 4 spike-ins. We will also provide simulated PacBio and ONT data as part of the evaluations. This particular study focuses on single strand CAGE sequencing of human iPSCs, defining CAGE peaks from Illumina HiSeq 2500 (SR: 150 cycles) of two biological replicates for use in the LRGASP challenge.
2021-10-27 | GSE185917 | GEO
Project description:Here we describe CapTrap-Seq, an experimental workflow designed to address the problem of reduced transcript end detection by long-read RNA sequencing methods, especially at the 5' ends. We apply CapTrap-Seq to profile transcriptomes of the human heart and brain and we compared the obtained results with other library preparation approaches. CapTrap-Seq is a platform-agnostic method and here tested the method by using 3 different long-read sequencing platforms: MinION (ONT), Sequel (PacBaio) and Sequel II (PacBio).
2023-12-20 | E-MTAB-13063 | biostudies-arrayexpress
Project description:Rapidly increased studies by third-generation sequencing [Pacific Biosciences (Pacbio) and Oxford Nanopore Technologies (ONT)] have been used in all kinds of research areas. Among them, the plant full-length single-molecule transcriptome studies were most used by Pacbio while ONT was rarely used. Therefore, in this study, we developed ONT RNA-sequencing methods in plants. We performed a detailed evaluation of reads from Pacbio and Nanopore PCR cDNA (ONT Pc) sequencing in plants (Arabidopsis), including the characteristics of raw data and identification of transcripts. We aimed to provide a valuable reference for applications of ONT in plant transcriptome analysis.
2019-12-15 | GSE141641 | GEO
Project description:To identify aberrant splicing isoforms and potential neoantigens, we performed full-length cDNA sequencing of lung adenocarcinoma cell lines using a long-read sequencer MinION. We constructed a comprehensive catalog of aberrant splicing isoforms and detected isoform-specific peptides using proteome analysis.
2020-12-09 | PXD019915 | JPOST Repository
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Investigation of transcriptome changes in four human cell lines (BJ, BJ-5ta, U2OS and HeLa) after treatment for 24 hours with nicotinamide adenine dinucleotide (NAD+). Cells were untreated as the control condition. Nanopore sequencing of cDNA was performed after library preparation with the ONT SQK-PCB109 kit.
2023-09-20 | E-MTAB-13187 | biostudies-arrayexpress
Project description:ONT Minion reads to provide 30x coverage for a patient with ataxia-pancytopenia syndrome.
| EGAD00001005022 | EGA