Project description:To provide a transcriptome resource for identification of transcripts where abundance correlated with developmental changes in willow plantlets derived from bud culture after transfer to soil.
Project description:Shrub willow (Salix spp.), a short rotation woody biomass crop, has superior properties as a perennial energy crop for the Northeast and Midwest US. However, the insect pest potato leafhopper Empoasca fabae (Harris) (PLH) can cause serious damage and reduce yield of susceptible genotypes. Currently, the willow cultivars in use display varying levels of susceptibility under PLH infestation. However, genes and markers for resistance to PLH are not yet available for marker-assisted selection in breeding. In this study, transcriptome differences between a resistant genotype 94006 (S. purpurea) and a susceptible cultivar ‘Jorr’ (S. viminalis), and their hybrid progeny were determined. Over 600 million RNA-Seq reads were generated and mapped to the Salix purpurea reference transcriptome. Gene expression analyses revealed the unique defense mechanism in resistant genotype 94006 that involves PLH-induced secondary cell wall modification. In the susceptible genotypes, genes involved in programed cell death were highly expressed, explaining the necrosis symptoms after potato leafhopper feeding. Overall, the discovery of resistance genes and defense mechanisms provides new resources for shrub willow breeding and research in the future.
Project description:We have conducted a season and subspecies comparasion on the two Willow Warbler subspecies Phylloscopus trochilus trochilus and Phylloscopus trochilus acredula. The analysis were performed by hybridizing cDNA from the Willow Warbler (Phylloscopus trochilus) on a Affymetrix costum array designed for the zebra finch (Taeniopygia guttata), the Lund-zf array.
Project description:Background: Saprobic fungi are the predominant industrial sources of Carbohydrate Active enZymes (CAZymes) used for the saccharification of lignocellulose during the production of second generation biofuels. The production of more effective enzyme cocktails is a key objective for efficient biofuel production. To achieve this objective, it is crucial to understand the response of fungi to lignocellulose substrates. Our previous study used RNA-seq to identify the genes induced in Aspergillus niger in response to wheat straw, a biofuel feedstock, and showed that the range of genes induced was greater than previously seen with simple inducers [GSE33852]. Results: In this work we used RNA-seq to identify the genes induced in A. niger in response to short rotation coppice willow and compared this with the response to wheat straw from our previous study, at the same time-point. The response to willow showed a large increase in expression of genes encoding CAZymes. Genes encoding the major activities required to saccharify lignocellulose were induced on willow such as endoglucanases, cellobiohydrolases and xylanases. The transcriptome response to willow had many similarities with the response to straw with some significant differences in the expression levels of individual genes which are discussed in relation to differences in substrate composition or other factors. Differences in transcript levels include higher levels on wheat straw from genes encoding enzymes classified as members of GH62 (an arabinofuranosidase) and CE1 (a feruloyl esterase) CAZy families whereas two genes encoding endoglucanases classified as members of the GH5 family had higher transcript levels when exposed to willow. There were changes in the cocktail of enzymes secreted by A. niger when cultured with willow or straw. Assays for particular enzymes as well as saccharification assays were used to compare the enzyme activities of the cocktails. Wheat straw induced an enzyme cocktail that saccharified wheat straw to a greater extent than willow. Genes not encoding CAZymes were also induced on willow such as hydrophobins as well as genes of unknown function. Several genes were identified as promising targets for future study. Conclusions: By comparing this first study of the global transcriptional response of a fungus to willow with the response to straw, we have shown that the inducing lignocellulosic substrate has a marked effect upon the range of transcripts and enzymes expressed by A. niger. The use by industry of complex substrates such as wheat straw or willow could benefit efficient biofuel production.
Project description:Background: Saprobic fungi are the predominant industrial sources of Carbohydrate Active enZymes (CAZymes) used for the saccharification of lignocellulose during the production of second generation biofuels. The production of more effective enzyme cocktails is a key objective for efficient biofuel production. To achieve this objective, it is crucial to understand the response of fungi to lignocellulose substrates. Our previous study used RNA-seq to identify the genes induced in Aspergillus niger in response to wheat straw, a biofuel feedstock, and showed that the range of genes induced was greater than previously seen with simple inducers [GSE33852]. Results: In this work we used RNA-seq to identify the genes induced in A. niger in response to short rotation coppice willow and compared this with the response to wheat straw from our previous study, at the same time-point. The response to willow showed a large increase in expression of genes encoding CAZymes. Genes encoding the major activities required to saccharify lignocellulose were induced on willow such as endoglucanases, cellobiohydrolases and xylanases. The transcriptome response to willow had many similarities with the response to straw with some significant differences in the expression levels of individual genes which are discussed in relation to differences in substrate composition or other factors. Differences in transcript levels include higher levels on wheat straw from genes encoding enzymes classified as members of GH62 (an arabinofuranosidase) and CE1 (a feruloyl esterase) CAZy families whereas two genes encoding endoglucanases classified as members of the GH5 family had higher transcript levels when exposed to willow. There were changes in the cocktail of enzymes secreted by A. niger when cultured with willow or straw. Assays for particular enzymes as well as saccharification assays were used to compare the enzyme activities of the cocktails. Wheat straw induced an enzyme cocktail that saccharified wheat straw to a greater extent than willow. Genes not encoding CAZymes were also induced on willow such as hydrophobins as well as genes of unknown function. Several genes were identified as promising targets for future study. Conclusions: By comparing this first study of the global transcriptional response of a fungus to willow with the response to straw, we have shown that the inducing lignocellulosic substrate has a marked effect upon the range of transcripts and enzymes expressed by A. niger. The use by industry of complex substrates such as wheat straw or willow could benefit efficient biofuel production. Six samples in total consisting of duplicate shake flask Aspergillus niger cultures from three conditions: glucose 48 h, willow 24 h, willow 24 h + glucose 5 h
Project description:The long noncoding RNA MALAT1 (metastasis-associated lung adenocarcinoma transcript 1), also known as MALAT-1 or NEAT2 (nuclear-enriched abundant transcript 2), is a highly conserved nuclear noncoding RNA (ncRNA). Two molecular functions of MALAT1 have been proposed, one is the control of alternative splicing and the other is the transcriptional regulation. To uncover its function in HCC, we knock down it in human HCC LM3 cell lines, and profiling the sample with LC/MS/MS and RNA sequencing.
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).