ONT RATTLE - fastqs
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB39835 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR4453632.fastq.gz | Fastqsanger.gz | |||
| ERR4453633.fastq.gz | Fastqsanger.gz | |||
| ERR4453634.fastq.gz | Fastqsanger.gz | |||
| ERR4453635.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 4 of 4 |
Similar Datasets
Project description:Reference-free reconstruction and quantification of transcriptomes from Nanopore long-read sequencing (signal files)
| PRJEB40335 | ENA
Project description:Transposon insertion site sequencing (TIS) is a powerful method for associating genotype to phenotype. However, all TIS methods described to date use short nucleotide sequence reads which cannot uniquely determine the locations of transposon insertions within repeating genomic sequences where the repeat units are longer than the sequence read length. To overcome this limitation, we have developed a TIS method using Oxford Nanopore sequencing technology that generates and uses long nucleotide sequence reads; we have called this method LoRTIS (Long Read Transposon Insertion-site Sequencing). This experiment data contains sequence files generated using Nanopore and Illumina platforms. Biotin1308.fastq.gz and Biotin2508.fastq.gz are fastq files generated from nanopore technology. Rep1-Tn.fastq.gz and Rep1-Tn.fastq.gz are fastq files generated using Illumina platform. In this study, we have compared the efficiency of two methods in identification of transposon insertion sites.
2022-05-30 | E-MTAB-11351 | biostudies-arrayexpress
Project description:Alternative splicing is widely acknowledged to be a crucial regulator of gene expression and is a key contributor to both normal developmental processes and disease states. While cost-effective and accurate for quantification, short-read RNA-seq lacks the ability to resolve full-length transcript isoforms despite increasingly sophisticated computational methods. Long-read sequencing platforms such as Pacific Biosciences (PacBio) and Oxford Nanopore (ONT) bypass the transcript reconstruction challenges of short-reads. Here we describe TALON, the ENCODE4 pipeline for analyzing PacBio cDNA and ONT direct-RNA transcriptomes. We apply TALON to three human ENCODE Tier 1 cell lines and show that while both technologies perform well at full-transcript discovery and quantification, each one displayed distinct artifacts. We further apply TALON to mouse cortical and hippocampal transcriptomes and find that a substantial proportion of neuronal genes have more reads associated with novel isoforms than with annotated ones. These data show that TALON is a technology-agnostic long-read transcriptome discovery and quantification pipeline capable of tracking both known and novel transcript models, as well as their expression levels, across datasets for both simple studies and in larger projects. These properties will enable TALON users to move beyond the limitations of short-read data to perform isoform discovery and quantification in a uniform manner on existing and future long-read platforms.
2020-03-18 | GSE147118 | GEO
Project description:Alternative splicing is widely acknowledged to be a crucial regulator of gene expression and is a key contributor to both normal developmental processes and disease states. While cost-effective and accurate for quantification, short-read RNA-seq lacks the ability to resolve full-length transcript isoforms despite increasingly sophisticated computational methods. Long-read sequencing platforms such as Pacific Biosciences (PacBio) and Oxford Nanopore (ONT) bypass the transcript reconstruction challenges of short-reads. Here we describe TALON, the ENCODE4 pipeline for analyzing PacBio cDNA and ONT direct-RNA transcriptomes. We apply TALON to three human ENCODE Tier 1 cell lines and show that while both technologies perform well at full-transcript discovery and quantification, each technology has its distinct artifacts. We further apply TALON to mouse cortical and hippocampal transcriptomes and find that a substantial proportion of neuronal genes have more reads associated with novel isoforms than annotated ones. The TALON pipeline for technology-agnostic, long-read transcriptome discovery and quantification tracks both known and novel transcript models as well as expression levels across datasets for both simple studies and larger projects such as ENCODE that seek to decode transcriptional regulation in the human and mouse genomes to predict more accurate expression levels of genes and transcripts than possible with short-reads alone.
2019-06-15 | GSE132766 | GEO
Project description:Transcriptomic profile of human adipose tissue progenitor cells was performed as follows. For AmpliSeq transcriptome sequencing library construction, AmpliSeq™ Library PLUS, AmpliSeq Transcriptome Human Gene Expression Panel and AmpliSeq CD indexes SetA kits were purchased from Illumina and sequencing libraries were constructed as described in AmpliSeq for Illumina Transcriptome Human Gene Expression Panel reference guide (Illumina). Equimolar concentrations of libraries were pooled at 4 nM and denatured and diluted as described in Denature and Dilute Libraries Guide (Illumina) and adjusted to final concentration of 1.4 pM. Resulting library was sequenced on NextSeq 500 using NextSeq 500/550 High Output v2 kit with 2 X 151 bp cycle. Generated raw files were converted to FASTQ files and used for data analysis. AmpliSeq transcriptome FASTQ files were analyzed on Array studio V10.0 (Omicsoft, Qiagen). Following raw read QC, first and last 10 bases were trimmed and mapped to reference genome Human.B38. The read count data was generated using GeneModel RefGene20170606. Resulting data was normalized by DESeq package, transformed to log2 value and used for ANOVA analyses.
2023-01-12 | GSE222749 | GEO
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Five-vertebrate ChIP-seq reveals the evolutionary dynamics of trancription factor binding. The SRF files for this experiment can be found in the European Read Archive with study accession number ERP000054. The fastq files can be found in the raw archives and for some assays links to the ENA runs and ENA fastq files are provided.
2010-04-08 | E-TABM-722 | biostudies-arrayexpress