Ontology highlight
ABSTRACT:
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| ERR726157.fastq.gz | Fastqsanger.gz | |||
| ERR726157_1.fastq.gz | Fastqsanger.gz | |||
| ERR726157_2.fastq.gz | Fastqsanger.gz | |||
| ERR726158.fastq.gz | Fastqsanger.gz | |||
| ERR726158_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:Amplicon-based sequencing of Pentavalent specific T-cells (unedited pathogen-specific T-cells targeting CMV, EBV, BKV, adenovirus and Aspergillus fumigatus) and Cerberus T-cells (CRISPR/Cas9 edited Glucocorticoid-resistant T-cells targeting CMV, EBV, BKV, adenovirus and Aspergillus fumigatus) for off-target sites prediction.
2021-01-14 | E-MTAB-9968 | biostudies-arrayexpress
Project description:Genome editing was conducted on a t(3;8) K562 model to investigate the effects of deleting different modules or CTCF binding sites within the MYC super-enhancer. To check mutations after targeting with CRISPR-Cas9 we performed amplicon sequencing using the Illumina PCR-based custom amplicon sequencing method using the TruSeq Custom Amplicon index kit (Illumina). The first PCR was performed using Q5 polymerase (NEB), the second nested PCR with KAPA HiFi HotStart Ready mix (Roche). Samples were sequenced paired-end (2x 250bp) on a MiSeq (Illumina).
2021-07-26 | E-MTAB-9937 | biostudies-arrayexpress
Project description:CRISPR/Cas9-based genome editing has revolutionized experimental molecular biology and entered the clinical world for targeted gene therapy. Identifying DNA modifications occurring at CRISPR/Cas9 target sites is critical to determine efficiency and safety of editing tools. Here we show that insertions of LINE-1 (L1) retrotransposons can occur frequently at CRISPR/Cas9 editing sites. Together with PolyA-seq and an improved amplicon sequencing, we characterize more than 2,500 de novo L1 insertions at multiple CRISPR/Cas9 editing sites in HEK293T, HeLa and U2OS cells. These L1 retrotransposition events exploit CRISPR/Cas9-induced DSB formation and require L1 RT activity. Importantly, de novo L1 insertions are rare during genome editing by prime editors (PE), cytidine or adenine base editors (CBE or ABE), consistent with their reduced DSB formation. These data demonstrate that insertions of retrotransposons might be a potential outcome of CRISPR/Cas9 genome editing and provide further evidence on the safety of different CRISPR-based editing tools.
2022-06-07 | GSE178440 | GEO
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description:To compare the impact of CRISPR-egineered R175 TP53 mutant variants in HCT116 and H460 cells, mutations at the amino acid position 175 were generated systematically by CRISP/Cas9 editing. Here, genomic amplicon regions covering the TP53 Exons 5 were sequenced via targeted sequencing.
2024-10-16 | E-MTAB-14322 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:To uncover, in an unbiased fashion, which elements of the 18 kb translocated region control EVI1 transcription, we devised a CRISPR/Cas9-based enhancer scanning approach. We considered all possible sgRNA target sites containing a canonical Cas9 PAM site (NGG) on both strands of the minimal 18 kb translocated region. Deep-sequencing libraries were generated by PCR amplification of sgRNA guide strands using primers that tag the product with standard Illumina adapters and a 4 bp sample barcode in a 2 step-PCR protocol.
2021-07-26 | E-MTAB-9948 | biostudies-arrayexpress