Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1001791 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR25501400.fastq.gz | Fastqsanger.gz | |||
| SRR25501401.fastq.gz | Fastqsanger.gz | |||
| SRR25501402.fastq.gz | Fastqsanger.gz | |||
| SRR25501403.fastq.gz | Fastqsanger.gz | |||
| SRR25501404_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 37 |
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Genome-wide distribution of topoisomerase I and DNA gyrase is directed by transcription induced supercoiling
2017-01-31 | GSE85357 | GEO
Project description:We report the genome-wide analysis from chromatin immunoprecipitated DNA (ChIP-sequencing) of the DNA binding pattern of ParBF (SopB) of plasmid F. This study, performed in E. coli and Salmonella typhimurium, investigates the impact of DNA supercoiling on ParBF DNA binding profiles in vivo. We found that variation in DNA supercoiling does not significantly affect the ParB DNA binding profiles even on linear DNA.
2024-07-01 | GSE256357 | GEO
Project description:This study was designed to investigate DNA supercoiling across the human genome and to understand how supercoiling domains impact on higher levels of genome organisation. DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes.
2013-02-17 | GSE43448 | GEO
Project description:This study was designed to investigate DNA supercoiling across the human genome and to understand how supercoiling domains impact on higher levels of genome organisation. DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes.
2013-02-17 | GSE43450 | GEO
Project description:This study aims to explore whether and how positive and negative supercoiling contribute to the three-dimensional (3D) organization of the bacterial genome. We used recently published Escherichia coli GapR ChIP-seq and TopoI ChIP-seq (also called EcTopoI-seq) data, which marks positive and negative supercoiling sites, respectively, to study how supercoiling correlates with the spatial contact maps obtained from chromosome conformation capture sequencing (Hi-C and 5C). We find that supercoiled chromosomal loci have overall higher Hi-C contact frequencies than sites that are not supercoiled. Surprisingly, positive supercoiling corresponds to higher spatial contact than negative supercoiling. Additionally, positive, but not negative, supercoiling could be identified from Hi-C data with high accuracy. We further find that the majority of positive and negative supercoils coincide with highly active transcription units, with a minor group associated with replication and other genomic processes. Our results show that both positive and negative supercoiling enhance spatial contact, with positive supercoiling playing a larger role in bringing genomic loci closer in space. Based on our results, we propose new physical models of how the E. coli chromosome is organized by positive and negative supercoils.
2023-11-03 | GSE214856 | GEO
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-09-22 | GSE149361 | GEO
Project description:We recently developed CHANGE-seq (Circularization for High-throughput Analysis of Nuclease Genome-wide Effects by Sequencing), a fast, streamlined, Tn5 tagmentation-based assay for measuring the genome-wide activity of Cas9 in vitro that is easily scalable to many targets and samples. In this study, we directly compare CIRCLE-seq to CHANGE-seq and systematically evaluate Cas9 genome-wide activity on 110 targets across 13 therapeutically-relevant loci leveraging CHANGE-seq. We validate the sensitivity of CHANGE-seq for identifying sites of bona fide cellular off-target mutations using GUIDE-seq and sensitive targeted tag sequencing. Additionally, we sought to evaluate the impact of chromatin accessibility on cellular off-target activity by comparing CHANGE-seq with matched GUIDE-seq cellular off-target, chromatin, and transcriptional profiles generated from the same human primary T-cells.
2020-06-15 | GSE149295 | GEO
Project description:This study was designed to investigate DNA supercoiling across the human genome and to understand how supercoiling domains impact on higher levels of genome organisation. DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes.
2013-02-17 | GSE43449 | GEO
Project description:Synthetic DNA-binding proteins have found broad application in gene therapies and as tools for interrogating biology. Engineered proteins based on the CRISPR/Cas9 and TALE systems have been used to alter genomic DNA sequences, control transcription of endogenous genes, and modify epigenetic states. Although the activity of these proteins at their intended genomic target sites have been assessed, the genome-wide effects of their action have not been extensively characterized. Additionally, the role of chromatin structure in determining the binding of CRISPR/Cas9 and TALE proteins to their target sites and the regulation of nearby genes is poorly understood. Characterization of the activity these proteins using modern high-throughput genomic methods would provide valuable insight into the specificity and off-target effects of CRISPR- and TALE-based genome engineering tools. We have analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators targeted to the promoters of two different endogenous human genes in HEK293T cells using a variety of high-throughput DNA sequencing methods. In particular, we assayed the DNA-binding specificity of these proteins and their effects on the epigenome. DNA-binding specificity was evaluated by ChIP-seq and RNA-seq was used to measure the specificity of these activators in perturbing the transcriptome. Additionally, DNase-seq was used to identify the chromatin state at target sites of the synthetic transcriptional activators and the genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these genome engineering technologies are highly specific in both binding to their promoter target sites and inducing expression of downstream genes when multiple activators bind to a single promoter. Moreover, we show that these synthetic activators are able to induce the expression of silent genes in heterochromatic regions of the genome by opening regions of closed chromatin and decreasing DNA methylation. Interestingly, the transcriptional activation domain was not necessary for DNA-binding or chromatin remodeling in these regions, but was critical to inducing gene expression. This study shows that these CRISPR- and TALE-based transcriptional activators are exceptionally specific. Although we detected limited binding of off-target sites in the genome and changes to genome structure, these off-target event did not lead to any detectable changes in gene regulation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function. HEK293T cells were transfected in triplicate with plasmids expressing synthetic transcription factors. The synthetic TFs were either (a) dCas9-VP64 fusion protein and a targeting guide RNA (gRNA), or (b) a TALE-VP64 fusion protein engineered to bind to a specific target site in the genome. As a control, cells were transfected with plasmids expressing GFP. After transfection, ChIP-seq was used to identify both on-target and off-target binding sites for the synthetic TFs.
2015-04-24 | E-GEOD-57085 | biostudies-arrayexpress