Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1113703 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR29150410_1.fastq.gz | Fastqsanger.gz | |||
| SRR29150410_2.fastq.gz | Fastqsanger.gz | |||
| SRR29150411_1.fastq.gz | Fastqsanger.gz | |||
| SRR29150411_2.fastq.gz | Fastqsanger.gz | |||
| SRR29150412_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 18 |
Similar Datasets
Project description:Intracellular pH (pHi) dynamics regulates diverse cell processes such as proliferation, dysplasia, and differentiation, often mediated by the protonation state of a functionally critical histidine residue in endogenous pH sensing proteins. How pHi dynamics can directly regulate gene expression and whether transcription factors can function as pH sensors has received limited attention. We tested the prediction that transcription factors with a histidine in their DNA binding domain (DBD) that forms hydrogen bonds with nucleotides can have pH-regulated activity, which is relevant to more than 85 transcription factors in distinct families, including FOX, KLF, SOX and MITF/Myc. Focusing on FOX family transcription factors, we used unbiased SELEX-seq to identify pH-dependent DNA binding motif preferences, then confirm pH-regulated binding affinities for FOXC2, FOXM1, and FOXN1 to a canonical FkhP DNA motif that are 2.5 to 7.5 greater at pH 7.0 compared with pH 7.5. For FOXC2, we also find greater activity for an FkhP motif at lower pHi in cells and that pH-regulated binding and activity are dependent on a conserved histidine (His122) in the DBD. RNA-seq with FOXC2 also reveals pH-dependent differences in enriched promoter motifs. Our findings identify pH-regulated transcription factor-DNA binding selectivity with relevance to how pHi dynamics can regulate gene expression for myriad cell behaviours.
2024-06-24 | GSE270232 | GEO
Project description:Intracellular pH (pHi) dynamics regulates diverse cell processes such as proliferation, dysplasia, and differentiation, often mediated by the protonation state of a functionally critical histidine residue in endogenous pH sensing proteins. How pHi dynamics can directly regulate gene expression and whether transcription factors can function as pH sensors has received limited attention. We tested the prediction that transcription factors with a histidine in their DNA binding domain (DBD) that forms hydrogen bonds with nucleotides can have pH-regulated activity, which is relevant to more than 85 transcription factors in distinct families, including FOX, KLF, SOX and MITF/Myc. Focusing on FOX family transcription factors, we used unbiased SELEX-seq to identify pH-dependent DNA binding motif preferences, then confirm pH-regulated binding affinities for FOXC2, FOXM1, and FOXN1 to a canonical FkhP DNA motif that are 2.5 to 7.5 greater at pH 7.0 compared with pH 7.5. For FOXC2, we also find greater activity for an FkhP motif at lower pHi in cells and that pH-regulated binding and activity are dependent on a conserved histidine (His122) in the DBD. RNA-seq with FOXC2 also reveals pH-dependent differences in enriched promoter motifs. Our findings identify pH-regulated transcription factor-DNA binding selectivity with relevance to how pHi dynamics can regulate gene expression for myriad cell behaviours.
2024-06-24 | GSE270316 | GEO
Project description:FOXC2-HIS122 and pH-dependent gene expression
| PRJNA1125484 | ENA
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress
Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.
2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM)
2015-03-01 | GSE60200 | GEO
Project description:In the context of human disease, the mechanisms whereby transcription factors reprogram gene expression in reparative responses to injury are not well understood. We have studied the mechanisms of transcriptional reprogramming in disease using murine kidney podocytes as a model for tissue injury. Podocytes are a crucial component of glomeruli, the filtration units of each nephron. Podocyte injury is the initial event in many processes that lead to End Stage Kidney Disease. FOXC2 is a transcription factor known to regulate gene expression in podocytes. FOXC2 and WT1 are both required for podocyte differentiation. Using murine models and human kidney organoids, we investigated FOXC2-mediated transcriptional reprogramming during the course of podocyte injury. Correlating FOXC2 and WT1 ChIP-seq analyses demonstrated that they co-bind many genes expressed in podocytes. Reprogramming the transcriptome involved highly dynamic changes in the binding of FOXC2 and WT1 to target genes during a reparative injury response.
2023-11-01 | GSE213174 | GEO
Project description:The FOXC2 transcription factor regulates a variety of developmental and biological processes in both embryonic and adult tissues. Importantly, overexpression or dysregulation of FOXC2 is also associated with oncogenic activity in numerous cancer types, though the function of FOXC2 in the context of melanoma has not been previously investigated. Therefore, the goal of this study was to assess FOXC2's regulation of gene expression in melanoma cells. To this end, we employed CRISPR-Cas9 gene editing technology to disrupt the Foxc2 gene in B16-F1 melanoma, and we performed RNA-seq analysis to assess differential gene expression between the wild-type B16-F1 melanoma cell line and our novel FOXC2-deficient B16-F1ΔFOXC2 gene-edited variant cell line.
2019-10-25 | GSE134296 | GEO
Project description:To determine gene expression changes in vasculogenic mimicry competent human breast cancer cells with loss of FOXC2 we performed RNA-seq of MDA-MB-231 cells with FOXC2 knockdown.
2023-07-26 | GSE232212 | GEO