The evolution of expression divergence in wild C. elegans
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1137531 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR29887600_1.fastq.gz | Fastqsanger.gz | |||
| SRR29887600_2.fastq.gz | Fastqsanger.gz | |||
| SRR29887601_1.fastq.gz | Fastqsanger.gz | |||
| SRR29887601_2.fastq.gz | Fastqsanger.gz | |||
| SRR29887602_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 90 |
Similar Datasets
Project description:To examine the ways in which gene expression varies in natural populations and its relationship to genetic divergence, we estimated allele-specific expression in the offspring of multiple wild C. elegans strains crossed with the laboratory reference strain N2. Allele-specific expression analyses are uniquely sensitively able to identify cis regulatory changes, and coupled with analyses of differential expression between parental strains and parents and offspring can determine the regulatory pattern and inheritance mode of gene expression across the genome. We chose 7 strains that represented a range of divergence from N2 and spanned the species tree to cross with N2: EG4348; DL238; CB4856 (the classical ‘Hawaiian’ strain); ECA722; QX1211; and ECA701 and XZ1516 (two extremely diverged strains). This study sheds light on the relationship of genetic and expression divergence, the global patterns of inheritance and regulatory mode of genes in C. elegans, and the factors that differentiate genes with expression divergence from those with stabler expression.
2024-10-14 | GSE272616 | GEO
Project description:Regulatory divergence during limb evolution
| PRJNA521485 | ENA
Project description:Regulatory divergence during pig limb evolution
| PRJNA521488 | ENA
Project description:Regulatory divergence during mouse limb evolution
| PRJNA521487 | ENA
Project description:This set of arrays contains all microarray experiments done involving comparisons among C. elegans natural isolates and mutation-accumulation lines. Abstract: The evolutionary importance of gene-expression divergence is unclear: some studies suggest that it is an important mechanism for evolution by natural selection, whereas others claim that most between-species regulatory changes are neutral or nearly neutral. We examined global transcriptional divergence patterns in a set of Caenorhabditis elegans mutation-accumulation lines and natural isolate lines to provide insights into the evolutionary importance of transcriptional variation and to discriminate between the forces of mutation and natural selection in shaping the evolution of gene expression. We detected the effects of selection on transcriptional divergence patterns and characterized them with respect to coexpressed gene sets, chromosomal clustering of expression changes and functional gene categories. We directly compared observed transcriptional variation patterns in the mutation-accumulation and natural isolate lines to a neutral model of transcriptome evolution to show that strong stabilizing selection dominates the evolution of transcriptional change for thousands of C. elegans expressed sequences. An all pairs experiment design type is where all labeled extracts are compared to every other labeled extract. Computed
2006-01-31 | E-GEOD-4123 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE28617: Function, targets and evolution of Caenorhabditis elegans piRNAs (small RNA-Seq) GSE37432: Function, targets and evolution of Caenorhabditis elegans piRNAs (mRNA) Refer to individual Series
2012-06-17 | E-GEOD-37433 | biostudies-arrayexpress
Project description:This set of arrays contains all microarray experiments done involving comparisons among C. elegans natural isolates and mutation-accumulation lines. Abstract: The evolutionary importance of gene-expression divergence is unclear: some studies suggest that it is an important mechanism for evolution by natural selection, whereas others claim that most between-species regulatory changes are neutral or nearly neutral. We examined global transcriptional divergence patterns in a set of Caenorhabditis elegans mutation-accumulation lines and natural isolate lines to provide insights into the evolutionary importance of transcriptional variation and to discriminate between the forces of mutation and natural selection in shaping the evolution of gene expression. We detected the effects of selection on transcriptional divergence patterns and characterized them with respect to coexpressed gene sets, chromosomal clustering of expression changes and functional gene categories. We directly compared observed transcriptional variation patterns in the mutation-accumulation and natural isolate lines to a neutral model of transcriptome evolution to show that strong stabilizing selection dominates the evolution of transcriptional change for thousands of C. elegans expressed sequences. An all pairs experiment design type is where all labeled extracts are compared to every other labeled extract. Keywords: all_pairs
2006-02-01 | GSE4123 | GEO
Project description:We analyzed the consequences of recombination in gene expression. For this, we measured expression patterns in two C. elegans wild types, N2 and CB4856 (CB). We compare these profiles with gene expression values from a Recombinant Inbred Population (RIL) derived from the same wild types. Expression values of the RILs (GSE17071) were obtained from Viñuela et al. (Genome Research, 2010). N2 and CB strain nematodes were cultured in identical conditions. Likewise, mRNA was extracted at three different ages (juveniles, reproductive and old worms) to investigate the transcriptional consequences of recombination in aging worms. Then, we explored gene expression heritability and transgression as genetic parameters for the analysis of gene expression divergence in natural isolates. Moreover, we investigated the progression of those parameters with age.
2012-04-01 | GSE22887 | GEO
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:To understand the evolution of imprinting mechanisms in the rice species Oryza sativa, we analyzed DNA methylation, transcription and small RNA expression in embryo and endosperm. Cultivars chosen to represent the genetic diversity of cultivated Oryza sativa comprised Nipponbare and Kitaake of the japonica subspecies, and IR64 and 93-11 cultivars of the indica subspecies. While imprinted expression is generally conserved among rice cultivars, approximately 10% of imprinted genes show imprinting divergence across the four cultivars. Analyses of DNA methylation and small RNAs revealed that small RNA producing loci are closely associated with genic regions and four times more likely to be imprinted than genes. However, imprinting divergence most often correlated with DNA methylation epimutations. Correlative epialleles were largely stable within subspecies. Small indels and transposable element insertions were found at half of the epimutated loci and associated with imprinting divergence at half of the remaining loci. Correlating epigenetic and genetic variation occurred at key regulatory regions – the promoter and transcription start site of maternally-biased genes, and the promoter and gene body of paternally-biased genes. Our results reinforce models for the role of maternal-specific DNA hypomethylation in imprint formation at both maternally and paternally biased genes, and highlight the role of transposition events and epimutation in rice imprinting evolution.
2021-06-29 | GSE130122 | GEO