Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1153389 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Gas hydrates, also known as clathrates, are cages of ice-like water crystals encasing gas molecules such as methane (CH4). Despite the global importance of gas hydrates, their microbiomes remain mysterious. Microbial cells are physically associated with hydrates, and the taxonomy of these hydrate-associated microbiomes is distinct from non-hydrate-bearing sites. Global 16S rRNA gene surveys show that members of sub-clade JS-1 of the uncultivated bacterial candidate phylum Atribacteria are the dominant taxa in gas hydrates. The Atribacteria phylogeny is highly diverse, suggesting the potential for wide functional variation and niche specialization. Here, we examined the distribution, phylogeny, and metabolic potential of uncultivated Atribacteria in cold, salty, and high-pressure sediments beneath Hydrate Ridge, off the coast of Oregon, USA, using a combination of 16S rRNA gene amplicon, metagenomic, and metaproteomic analysis. Methods were developed to extract bacterial cellular protein from these sediments, as outlined below. Sample Description Three sediments samples were collected from beneath Hydrate Ridge, off the coast of Oregon, USA. Sediments were cored at ODP site 1244 (44°35.1784´N; 125°7.1902´W; 895 m water depth) on the eastern flank of Hydrate Ridge ~3 km northeast of the southern summit on ODP Leg 204 in 2002 and stored at -80°C at the IODP Gulf Coast Repository. E10H5 sediment is from 68.5 meters below sediment surface interface C1H2 sediment is from 2 meters below sediment surface interface. C3H4 sediment is from 21 meters below sediment surface interface.
2020-01-22 | PXD012479 | Pride
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:Protein expression in Staphylococcus sp. NIOSBK35 isolated from marine environment (mangrove sediments) to different concentrations of arsenic (III)
2019-12-02 | PXD013569 | Pride
Project description:To study the responses of microbial communities to short-term nitrogen addition and warming,here we examine microbial communities in mangrove sediments subjected to a 4-months experimental simulation of eutrophication with 185 g m-2 year-1 nitrogen addition (N), 3oC warming (W) and nitrogen addition*warming interaction (NW).
2022-03-01 | GSE190739 | GEO
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
2023-11-07 | PXD037975 | JPOST Repository
Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.
| 2255499 | ecrin-mdr-crc
Project description:Mitochondrial rRNAs play important roles in regulating mtDNA-encoded gene expression and energy metabolism subsequently. However, the proteins that regulate mitochondrial 16S rRNA processing remain poorly understood. Herein, we generated adipose-specific Wbscr16-/- mice and cells, both of which exhibited dramatic mitochondrial changes. Subsequently, WBSCR16 was identified as a 16S rRNA-binding protein essential for the cleavage of 16S rRNA-mt-tRNALeu, facilitating 16S rRNA processing and mitochondrial ribosome assembly. Additionally, WBSCR16 recruited RNase P subunit MRPP3 to nascent 16S rRNA and assisted in this specific cleavage. Furthermore, evidence showed that adipose-specific Wbscr16 ablation promotes energy wasting via lipid preference in brown adipose tissue, leading to excess energy expenditure and resistance to obesity. In contrast, overexpression of WBSCR16 upregulated 16S rRNA processing and induced a preference for glucose utilization in both transgenic mouse models and cultured cells. These findings suggest that WBSCR16 plays essential roles in mitochondrial 16S rRNA processing in mammals, and is the key mitochondrial protein to balance glucose and lipid metabolism.
2024-12-30 | GSE229693 | GEO
Project description:Interventions: Experimental group:Dietary fiber;Control:Non-Dietary fiber
Primary outcome(s): Hgb, ALB, PAB, TRF, LYM, CD3+, CD3+CD4+, CD3+CD8+, CD16+CD56+, CD19+, IgA, IgG, IgM;16S rRNA gene v3v4 variable region
Study Design: Randomized parallel controlled trial
| 2666161 | ecrin-mdr-crc
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO