Rapid discovery of cyclic peptide protein aggregation inhibitors through continuous selection HTS data
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1170358 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| Other | ||||
| SRR30916246_1.fastq.gz | Fastqsanger.gz | |||
| SRR30916246_2.fastq.gz | Fastqsanger.gz | |||
| SRR30916247_1.fastq.gz | Fastqsanger.gz | |||
| SRR30916247_2.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 15 |
Similar Datasets
Project description:We report a new platform for the rapid phenotypic selection of protein aggregation inhibitors from genetically encoded cyclic peptide libraries in E. coli based on phage-assisted continuous evolution (PACE). Here, we developed a new PACE-compatible selection for protein aggregation inhibition and employed it to identify cyclic peptides that suppress amyloid-β42 (Aβ42) and human islet amyloid polypeptide (hIAPP) aggregation. Additionally, we integrated a negative selection that removes false positives and off-target hits, significantly improving cyclic peptide selectivity. We show that selected inhibitors are active when chemically re-synthesized in in vitro assays. Our platform provides a powerful new approach for the rapid discovery of cyclic peptide inhibitors of protein aggregation and may serve as the basis for the future evolution of cyclic peptides with a broad spectrum of inhibitory activities. Data deposited here are HTS data critical to the conclusions of this study.
2024-10-25 | GSE279094 | GEO
Project description:mRNA profiles of control Human Trophoblast Stem cell (HTS) and TEAD4 knock down HTS cells were generated by deep sequencing, in triplicate, using Illumina NovaSeq 6000 platform. TEAD4 Knock down in HTS cells were confirmed by RT-PCR analysis and immuno staining.
2020-05-29 | GSE144809 | GEO
Project description:Staphylococcus aureus is an opportunistic pathogen capable of causing various infections ranging from superficial skin infections to life-threatening severe diseases, including pneumonia and sepsis. This bacterium is attached to biotic and abiotic surfaces and forms biofilms that are resistant to conventional antimicrobial agents and clearance by host defenses. Infections associated with biofilms may result in longer hospitalizations, a need for surgery, and may even result in death. Agents that inhibit the formation of biofilms and virulence without affecting bacterial growth to avoid the development of drug resistance could be useful for therapeutic purposes. In this regard, we identified and isolated a small cyclic peptide, gurmarin, from a plant source that inhibited the formation of S. aureus biofilm without affecting the growth rate of the bacterium. We determined the gene expression of S. aureus biofilm treated with gurmarin and compared it to the untreated control biofilms. Differentially expressed genes were identified and their roles in the inhibition of S. aureus biofilms by gurmarin were analyzed.
2022-09-21 | E-MTAB-12154 | biostudies-arrayexpress
Project description:Aberrant protein aggregation jeopardize cellular functionality and underlies the development of a myriad of late-onset maladies including Alzheimer’s disease (AD) and Huntington’s disease (HD). Accordingly, molecules that mitigate the toxicity of hazardous protein aggregates are of great interest as potential future therapeutics. Here we asked whether a small peptide, composed of five amino acids (5MER peptide) that was derived from the human pro-inflammatory CD44, could protect model nematodes from the toxicity of aggregative proteins that underlie the development of neurodegenerative disorders in humans. We found that the 5MER peptide mitigates the toxicity that stems from both, the AD-causing Aβ peptide and a stretch of poly-glutamine that is accountable to the development of several disorders including HD, without affecting lifespan. This protection was dependent on the activity of the aging-regulating transcription factors and associated with enhanced Aβ and polyQ35-YFP aggregation. A transcriptomic analysis unveiled that the peptide modulates the expression of various genes including these which are known as protein homeostasis (proteostasis) regulators such as txt-13, and modifiers of proteasome activity. The knockdown of txt-13 protects worms from proteotoxicity to the same extent as the 5MER peptide, suggesting that the peptide activates the transcellular chaperone signaling to promote proteostasis. Together, our results propose that the 5MER peptide should be considered as a component of future therapeutic cocktails for the treatment of neurodegenerative maladies.
2023-12-27 | GSE230640 | GEO
Project description:C-Terminal cyclic imides are post-translational modifications (PTMs) that can arise from spontaneous intramolecular cleavage of asparagine or glutamine residues resulting in a form of irreversible protein damage. These protein damage events are recognized and removed by the E3 ligase substrate adapter cereblon (CRBN), indicating that this class of aging-related modifications requires cellular quality control mechanisms to prevent deleterious effects. However, the factors that determine protein or peptide susceptibility to C-terminal cyclic imide formation or their effect on protein stability have not been explored in detail. Here, we characterize the primary and secondary structures of peptides and proteins that promote intrinsic formation of C-terminal cyclic imides in comparison to deamidation, a related form of protein damage. Extrinsic effects from solution properties and stressors on the cellular proteome additionally promote C-terminal cyclic imide formation on proteins like glutathione synthetase (GSS) that are susceptible to aggregation if they are not removed by CRBN. This systematic investigation provides insight to the regions of the proteome that are prone to these unexpectedly frequent modifications, the effects of this form of protein damage on the protein stability, and the biological role of CRBN.
2024-08-08 | PXD054016 | Pride
Project description:Display technologies, e.g., phage, ribosome, mRNA, bacterial, and yeast-display, combine high content peptide libraries with appropriate screening strategies to identify functional peptide sequences. Construction of large peptide library and display-screen system in intact mammalian cells will facilitate the development of peptide therapeutics targeting transmembrane proteins. Our previous work established linear-double-stranded DNAs (ldsDNAs) as innovative biological parts to implement AND gate genetic circuits in mammalian cell line. In the current study, we employ ldsDNA with terminal NNK degenerate codons as AND gate input to build highly diverse peptide library in mammalian cells. Only PCR reaction and cell transfection experiments are needed to construct the library. High-throughput sequencing (HTS) results reveal that our new strategy could generate peptide library with both amino acid sequence and peptide length diversities. Our work establishes ldsDNA as biological parts for building highly diverse peptide library in mammalian cells, which shows great application potential in developing therapeutic peptides targeting transmembrane proteins.
2020-07-19 | GSE134671 | GEO
Project description:HTS data as a source of diatom barcode sequences
| PRJEB27890 | ENA
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Calcium and integrin binding protein 1 (CIB1) is a small, intracellular protein recently implicated in survival and proliferation of triple-negative breast cancer (TNBC). Considering its interactions with PAK1 and downstream signaling, CIB1 has been suggested as a potential therapeutic target in TNBC. As such, CIB1 has been the focus of inhibitor discovery efforts. To overcome issues of potency and stability in previously reported CIB1 inhibitors, we deploy mRNA display to discover new cyclic peptide inhibitors with improved biophysical properties and cellular activity. We advance UNC10245131, a cyclic peptide with low nanomolar affinity and good selectivity for CIB1 over other EF-hand domain proteins and improved permeability and stability over previously identified linear peptide inhibitor UNC10245092. Unlike UNC10245092, UNC10245131 lacks cytotoxicity and does not affect downstream signaling. Despite this, UNC10245131 is a potent ligand that could aid in clarifying roles of CIB1 in TNBC survival and proliferation and other CIB1-associated biological phenotypes.
| S-EPMC8591747 | biostudies-literature
Project description:MicroRNAs (miRNAs) are short RNAs that regulate fundamental biological processes. miR-132, a key miRNA with established functions in Tau homeostasis and neuroprotection, is consistently downregulated in Alzheimer’s disease (AD) and other tauopathies. miR-132 overexpression rescues neurodegenerative phenotypes in several AD models. To complement research on miRNA-mimicking oligonucleotides targeting the central nervous system, we developed a high-throughput-screen coupled high-throughput-sequencing (HTS-HTS) in human induced pluripotent stem cell (iPSC)-derived neurons to identify small molecule inducers of miR-132. We discovered that cardiac glycosides, which are canonical sodium-potassium ATPase inhibitors, selectively upregulated miR-132 in the sub-μM range. Coordinately, cardiac glycoside treatment downregulated total and phosphorylated Tau in rodent and human neurons and protected against toxicity by glutamate, N-methyl-D-aspartate, rotenone, and Aβ oligomers. In conclusion, we identified small-molecule drugs that upregulated the neuroprotective miR-132 and ameliorated neurodegenerative phenotypes. Our dataset also represents a comprehensive resource for discovering small molecules that modulate specific miRNAs for therapeutic purposes.
2023-10-19 | GSE216991 | GEO