Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA153117 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR424671.fastq.gz | Fastqsanger.gz | |||
| SRR424672.fastq.gz | Fastqsanger.gz | |||
| SRR424673.fastq.gz | Fastqsanger.gz | |||
| SRR424674.fastq.gz | Fastqsanger.gz | |||
| SRR424675.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:While the importance of random sequencing errors decreases at higher DNA or RNA sequencing depths, systematic sequencing errors (SSEs) dominate at high sequencing depths and can be difficult to distinguish from biological variants. These SSEs can cause base quality scores to underestimate the probability of error at certain genomic positions, resulting in false positive variant calls, particularly in mixtures such as samples with RNA editing, tumors, circulating tumor cells, bacteria, mitochondrial heteroplasmy, or pooled DNA. Most algorithms proposed for correction of SSEs require a training data set, which is typically either from a part of the data set being M-bM-^@M-^\recalibratedM-bM-^@M-^] (Genome Analysis ToolKit, or GATK) or from a separate data set with special characteristics (SysCall). Here, we combine the advantages of these approaches by adding synthetic RNA spike-in standards to human RNA, and use GATK to recalibrate base quality scores with reads mapped to the spike-in standards. Compared to conventional GATK recalibration that uses reads mapped to the genome, spike-ins improve the accuracy of Illumina base quality scores by a mean of 5 units, and by as much as 13 units M-BM- at CpG sites. In addition, since reads mapping to the genome are not used for recalibration, our method allows run-specific recalibration even for the many species without a comprehensive and accurate SNP database. We also use GATK with the spike-in standards to demonstrate that the Illumina RNA sequencing runs overestimate quality scores for AC, CC, GC, GG, and TC dinucleotides, while SOLiD has less dinucleotide SSEs but more SSEs for certain cycles. We conclude that using these DNA and RNA spike-in standards with GATK improves base quality score recalibration. Four human RNA samples with equimolar ERCC spike-in standards were sequenced on Illumina. Two human brain/liver/muscle RNA mixtures with dynamic range of ERCC spike-in standards were sequenced on SOLiD.
2012-03-03 | E-GEOD-36217 | biostudies-arrayexpress
Project description:While the importance of random sequencing errors decreases at higher DNA or RNA sequencing depths, systematic sequencing errors (SSEs) dominate at high sequencing depths and can be difficult to distinguish from biological variants. These SSEs can cause base quality scores to underestimate the probability of error at certain genomic positions, resulting in false positive variant calls, particularly in mixtures such as samples with RNA editing, tumors, circulating tumor cells, bacteria, mitochondrial heteroplasmy, or pooled DNA. Most algorithms proposed for correction of SSEs require a training data set, which is typically either from a part of the data set being “recalibrated” (Genome Analysis ToolKit, or GATK) or from a separate data set with special characteristics (SysCall). Here, we combine the advantages of these approaches by adding synthetic RNA spike-in standards to human RNA, and use GATK to recalibrate base quality scores with reads mapped to the spike-in standards. Compared to conventional GATK recalibration that uses reads mapped to the genome, spike-ins improve the accuracy of Illumina base quality scores by a mean of 5 units, and by as much as 13 units at CpG sites. In addition, since reads mapping to the genome are not used for recalibration, our method allows run-specific recalibration even for the many species without a comprehensive and accurate SNP database. We also use GATK with the spike-in standards to demonstrate that the Illumina RNA sequencing runs overestimate quality scores for AC, CC, GC, GG, and TC dinucleotides, while SOLiD has less dinucleotide SSEs but more SSEs for certain cycles. We conclude that using these DNA and RNA spike-in standards with GATK improves base quality score recalibration.
2012-03-03 | GSE36217 | GEO
Project description:Kynureninase is a member of a large family of catalytically diverse but structurally homologous pyridoxal 5'-phosphate (PLP) dependent enzymes known as the aspartate aminotransferase superfamily or alpha-family. The Homo sapiens and other eukaryotic constitutive kynureninases preferentially catalyze the hydrolytic cleavage of 3-hydroxy-l-kynurenine to produce 3-hydroxyanthranilate and l-alanine, while l-kynurenine is the substrate of many prokaryotic inducible kynureninases. The human enzyme was cloned with an N-terminal hexahistidine tag, expressed, and purified from a bacterial expression system using Ni metal ion affinity chromatography. Kinetic characterization of the recombinant enzyme reveals classic Michaelis-Menten behavior, with a Km of 28.3 +/- 1.9 microM and a specific activity of 1.75 micromol min-1 mg-1 for 3-hydroxy-dl-kynurenine. Crystals of recombinant kynureninase that diffracted to 2.0 A were obtained, and the atomic structure of the PLP-bound holoenzyme was determined by molecular replacement using the Pseudomonas fluorescens kynureninase structure (PDB entry 1qz9) as the phasing model. A structural superposition with the P. fluorescens kynureninase revealed that these two structures resemble the "open" and "closed" conformations of aspartate aminotransferase. The comparison illustrates the dynamic nature of these proteins' small domains and reveals a role for Arg-434 similar to its role in other AAT alpha-family members. Docking of 3-hydroxy-l-kynurenine into the human kynureninase active site suggests that Asn-333 and His-102 are involved in substrate binding and molecular discrimination between inducible and constitutive kynureninase substrates.
| S-EPMC2531291 | biostudies-literature
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards.
2009-06-03 | GSE14695 | GEO
Project description:RNA extracted at 240min. Samples are rRNA depleted. Expression measurement of Homo sapiens genes.
2019-07-31 | GSE114179 | GEO
Project description:As the evolution of miRNA genes has been found to be one of the important factors in formation of the modern type of man, we performed a comparative analysis of the evolution of miRNA genes in two archaic hominines, Homo sapiens neanderthalensis and Homo sapiens denisova, and elucidated the expression of their target mRNAs in bain.A comparative analysis of the genomes of primates, including species in the genus Homo, identified a group of miRNA genes having fixed substitutions with important implications for the evolution of Homo sapiens neanderthalensis and Homo sapiens denisova. The mRNAs targeted by miRNAs with mutations specific for Homo sapiens denisova exhibited enhanced expression during postnatal brain development in modern humans. By contrast, the expression of mRNAs targeted by miRNAs bearing variations specific for Homo sapiens neanderthalensis was shown to be enhanced in prenatal brain development.Our results highlight the importance of changes in miRNA gene sequences in the course of Homo sapiens denisova and Homo sapiens neanderthalensis evolution. The genetic alterations of miRNAs regulating the spatiotemporal expression of multiple genes in the prenatal and postnatal brain may contribute to the progressive evolution of brain function, which is consistent with the observations of fine technical and typological properties of tools and decorative items reported from archaeological Denisovan sites. The data also suggest that differential spatial-temporal regulation of gene products promoted by the subspecies-specific mutations in the miRNA genes might have occurred in the brains of Homo sapiens denisova and Homo sapiens neanderthalensis, potentially contributing to the cultural differences between these two archaic hominines.
| S-EPMC4686780 | biostudies-literature
Project description:PurposeWe investigated the evidence of recent positive selection in the human phototransduction system at single nucleotide polymorphism (SNP) and gene level.MethodsSNP genotyping data from the International HapMap Project for European, Eastern Asian, and African populations was used to discover differences in haplotype length and allele frequency between these populations. Numeric selection metrics were computed for each SNP and aggregated into gene-level metrics to measure evidence of recent positive selection. The level of recent positive selection in phototransduction genes was evaluated and compared to a set of genes shown previously to be under recent selection, and a set of highly conserved genes as positive and negative controls, respectively.ResultsSix of 20 phototransduction genes evaluated had gene-level selection metrics above the 90th percentile: RGS9, GNB1, RHO, PDE6G, GNAT1, and SLC24A1. The selection signal across these genes was found to be of similar magnitude to the positive control genes and much greater than the negative control genes.ConclusionsThere is evidence for selective pressure in the genes involved in retinal phototransduction, and traces of this selective pressure can be demonstrated using SNP-level and gene-level metrics of allelic variation. We hypothesize that the selective pressure on these genes was related to their role in low light vision and retinal adaptation to ambient light changes. Uncovering the underlying genetics of evolutionary adaptations in phototransduction not only allows greater understanding of vision and visual diseases, but also the development of patient-specific diagnostic and intervention strategies.
| S-EPMC3743458 | biostudies-literature
Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress
Project description:Cortical thickness has been investigated since the beginning of the 20th century, but we do not know how similar the cortical thickness profiles among humans are. In this study, the local similarity of cortical thickness profiles was investigated using sliding window methods. Here, we show that approximately 5% of the cortical thickness profiles are similarly expressed among humans while 45% of the cortical thickness profiles show a high level of heterogeneity. Therefore, heterogeneity is the rule, not the exception. Cortical thickness profiles of somatosensory homunculi and the anterior insula are consistent among humans, while the cortical thickness profiles of the motor homunculus are more variable. Cortical thickness profiles of homunculi that code for muscle position and skin stimulation are highly similar among humans despite large differences in sex, education, and age. This finding suggests that the structure of these cortices remains well preserved over a lifetime. Our observations possibly relativize opinions on cortical plasticity.
| S-EPMC5738339 | biostudies-literature
Project description:Acute cellular stress is known to induce a global reduction in protein translation through suppression of cap dependent translation. However, selective translation in response to acute stress has been shown to play important roles in regulating the stress response. An accurate transcriptome-wide profile of acute cellular stress-induced translational changes has been challenging to obtain. Commonly used data normalization methods, such as quantile normalization, operate based on the assumption that any systematic shifts are artifacts introduced from experimental procedures. Consequently, if applied to profiling acute cellular stress-induced protein translation changes, these methods are expected to produce biased estimates. To address this issue, here we designed, generated, and evaluated a panel of 16 oligomers to serve as external standards for ribosome profiling studies. Using Sodium Arsenite treatment-induced oxidative stress in lymphoblastoid cell lines as a model system, we applied spike-in oligomers as external standards based on quantifications of monosomal RNA extracted from each sample. We found our spike-in oligomers to display a linear correlation between the observed and the expected, with small but significant ratio compression at the lower concentration range, and span the expected quantitative range in the observed data, which covers 97 % of the quantitated endogenous genes. We found popular global scaling normalization approaches to introduce both high levels of false positives and false negatives in differential expression analysis. Using the expected fold changes constructed from spike-in external controls, we found in our dataset that TMM normalization produced 87.5% false positives when a P value cutoff of 0.1 is used (i.e. 10% expected false positive rate) and on average produced a systematic shift of fold change by 3.25 fold. These results highlight the consequences of applying global scaling approaches to conditions that clearly violate their key assumptions. As an alternative, we found using spike-in quantifications as control genes in RUVg normalization recapitulated the expected stress induced global reduction of translation, and resulted in little, if any, systematic shifts in spike-in constructed true positives. Finally, using spike-in constructed true positives and true negatives, we explored alternative normalization approaches for acute cellular stress response ribo-seq studies. We found that a simple approach that quantile normalized data from control and treated samples separately, which we termed respective quantile normalization, produced expected results in spike-in quantification, and resulted in little, if any, systematic bias on fold change in endogenous genes. Additionally, we found that under certain parameters, using endogenous control genes for RUVg normalization best recapitulate the expected. Our results clearly demonstrated the utility of our spike-in oligomers, both for constructing expected results as controls and for data normalization. Our exploration of different normalization approaches highlights the issues in applying global scaling normalization when key assumptions are clearly not met. We show that a respective quantile normalization approach or normalization with endogenous control genes are viable options worth considering as a more generalizable approach for stress response ribo-seq studies. This conclusion is likely applicable to other types of studies that involve global shifts in expression profiles between comparison groups of interests.
2022-09-10 | GSE212714 | GEO