Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
Project description:RNA-Seq after Cas9-gRNA transfection with different length gRNAs we performed PolyA Selection and RNA-Seq on cells transfected with dCas9-VPR and a gRNA of each length (20nt, 16nt, or 14nt) targeting ACTC1, MIAT, or HBG1/2
Project description:We have sequenced miRNA libraries from human embryonic, neural and foetal mesenchymal stem cells. We report that the majority of miRNA genes encode mature isomers that vary in size by one or more bases at the 3’ and/or 5’ end of the miRNA. Northern blotting for individual miRNAs showed that the proportions of isomiRs expressed by a single miRNA gene often differ between cell and tissue types. IsomiRs were readily co-immunoprecipitated with Argonaute proteins in vivo and were active in luciferase assays, indicating that they are functional. Bioinformatics analysis predicts substantial differences in targeting between miRNAs with minor 5’ differences and in support of this we report that a 5’ isomiR-9-1 gained the ability to inhibit the expression of DNMT3B and NCAM2 but lost the ability to inhibit CDH1 in vitro. This result was confirmed by the use of isomiR-specific sponges. Our analysis of the miRGator database indicates that a small percentage of human miRNA genes express isomiRs as the dominant transcript in certain cell types and analysis of miRBase shows that 5’ isomiRs have replaced canonical miRNAs many times during evolution. This strongly indicates that isomiRs are of functional importance and have contributed to the evolution of miRNA genes
Project description:Kynureninase is a member of a large family of catalytically diverse but structurally homologous pyridoxal 5'-phosphate (PLP) dependent enzymes known as the aspartate aminotransferase superfamily or alpha-family. The Homo sapiens and other eukaryotic constitutive kynureninases preferentially catalyze the hydrolytic cleavage of 3-hydroxy-l-kynurenine to produce 3-hydroxyanthranilate and l-alanine, while l-kynurenine is the substrate of many prokaryotic inducible kynureninases. The human enzyme was cloned with an N-terminal hexahistidine tag, expressed, and purified from a bacterial expression system using Ni metal ion affinity chromatography. Kinetic characterization of the recombinant enzyme reveals classic Michaelis-Menten behavior, with a Km of 28.3 +/- 1.9 microM and a specific activity of 1.75 micromol min-1 mg-1 for 3-hydroxy-dl-kynurenine. Crystals of recombinant kynureninase that diffracted to 2.0 A were obtained, and the atomic structure of the PLP-bound holoenzyme was determined by molecular replacement using the Pseudomonas fluorescens kynureninase structure (PDB entry 1qz9) as the phasing model. A structural superposition with the P. fluorescens kynureninase revealed that these two structures resemble the "open" and "closed" conformations of aspartate aminotransferase. The comparison illustrates the dynamic nature of these proteins' small domains and reveals a role for Arg-434 similar to its role in other AAT alpha-family members. Docking of 3-hydroxy-l-kynurenine into the human kynureninase active site suggests that Asn-333 and His-102 are involved in substrate binding and molecular discrimination between inducible and constitutive kynureninase substrates.
Project description:As the evolution of miRNA genes has been found to be one of the important factors in formation of the modern type of man, we performed a comparative analysis of the evolution of miRNA genes in two archaic hominines, Homo sapiens neanderthalensis and Homo sapiens denisova, and elucidated the expression of their target mRNAs in bain.A comparative analysis of the genomes of primates, including species in the genus Homo, identified a group of miRNA genes having fixed substitutions with important implications for the evolution of Homo sapiens neanderthalensis and Homo sapiens denisova. The mRNAs targeted by miRNAs with mutations specific for Homo sapiens denisova exhibited enhanced expression during postnatal brain development in modern humans. By contrast, the expression of mRNAs targeted by miRNAs bearing variations specific for Homo sapiens neanderthalensis was shown to be enhanced in prenatal brain development.Our results highlight the importance of changes in miRNA gene sequences in the course of Homo sapiens denisova and Homo sapiens neanderthalensis evolution. The genetic alterations of miRNAs regulating the spatiotemporal expression of multiple genes in the prenatal and postnatal brain may contribute to the progressive evolution of brain function, which is consistent with the observations of fine technical and typological properties of tools and decorative items reported from archaeological Denisovan sites. The data also suggest that differential spatial-temporal regulation of gene products promoted by the subspecies-specific mutations in the miRNA genes might have occurred in the brains of Homo sapiens denisova and Homo sapiens neanderthalensis, potentially contributing to the cultural differences between these two archaic hominines.
Project description:PurposeWe investigated the evidence of recent positive selection in the human phototransduction system at single nucleotide polymorphism (SNP) and gene level.MethodsSNP genotyping data from the International HapMap Project for European, Eastern Asian, and African populations was used to discover differences in haplotype length and allele frequency between these populations. Numeric selection metrics were computed for each SNP and aggregated into gene-level metrics to measure evidence of recent positive selection. The level of recent positive selection in phototransduction genes was evaluated and compared to a set of genes shown previously to be under recent selection, and a set of highly conserved genes as positive and negative controls, respectively.ResultsSix of 20 phototransduction genes evaluated had gene-level selection metrics above the 90th percentile: RGS9, GNB1, RHO, PDE6G, GNAT1, and SLC24A1. The selection signal across these genes was found to be of similar magnitude to the positive control genes and much greater than the negative control genes.ConclusionsThere is evidence for selective pressure in the genes involved in retinal phototransduction, and traces of this selective pressure can be demonstrated using SNP-level and gene-level metrics of allelic variation. We hypothesize that the selective pressure on these genes was related to their role in low light vision and retinal adaptation to ambient light changes. Uncovering the underlying genetics of evolutionary adaptations in phototransduction not only allows greater understanding of vision and visual diseases, but also the development of patient-specific diagnostic and intervention strategies.