Oryza sativa Japonica Group
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA267569 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR1654490.fastq.gz | Fastqsanger.gz | |||
| SRR1654491.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 2 of 2 |
Similar Datasets
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing.
2008-12-08 | GSE12317 | GEO
Project description:Phosphate starvation/sufficient rice seedling, root or shoot Pi-starvation or Pi-sufficient stresses responsible rice genes, including previously unannotated genes were identified by Illumina mRNA-seq technology. 53 million reads from Pi-starvation or Pi-sufficient root or shoot tissues were uniquely mapped to the rice genome, and these included 40574 RAP3 transcripts in root and 39748 RAP3 transcripts in shoot. We compared our mRNA-seq expression data with that from Rice 44K oligomicroarray, and about 95.5% (root) and 95.4% (shoot) transcripts supported by the array were confirmed expression both by the array and by mRNA-seq, Moreover, 11888 (root) and 11098 (shoot) RAP genes which were not supported by array, were evidenced expression with mRNA-seq. Furthermore, we discovered 8590 (root) and 8193 (shoot) previously unannotated transcripts upon Pi-starvation and/or Pi-sufficient.
2012-01-06 | E-MTAB-4302 | biostudies-arrayexpress
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. Totally three sets of small RNAs, which were obtained under normal condition as well as salt and drought stress conditions
2008-12-08 | E-GEOD-12317 | biostudies-arrayexpress
Project description:In this study, we examined the transcriptome dynamics within the matured fully expanded rice leaf and used strand-specific RNA sequencing to generate a comprehensive transcriptome dataset for the mature rice leaf. The rice Nipponbare (Oryza sativa l. japonica) seedlings were grown in the greenhouse. About 20 days after planting, the fully opened 4th leaves was cut it into seven 3-cm segments, from bottom to tip and labeled as sections 1 to 7, respectively. The tissues were immediately frozen in liquid nitrogen for total RNA extraction. Two biological replicates were collected for each section. Note: All samples in SRA were assigned the same sample accession (SRS685294). This is incorrect as there are different samples, hence âSource Nameâ was replaced with new values. Comment[ENA_SAMPLE] contains the original SRA sample accessions.
2015-08-16 | E-MTAB-4372 | biostudies-arrayexpress
Project description:Dynamic and coordinated expression changes of rice small RNAs in response to Xanthomonas oryzae pv. oryzae
| PRJNA252424 | ENA
Project description:Small RNA and PARE sequencing in rice (photoperiod sensitive male sterility lines and wild type) panicles under long-day and short-day conditions
| PRJNA335548 | ENA
Project description:Transcriptome profiles of the rice coleoptile of wild type and reduced adh activity (rad) mutant
| PRJNA136451 | ENA
Project description:Comparative analysis of transformed and wild-type rice genome.
| PRJDB3395 | ENA
Project description:Expression data from shoots of rice seedlings after inoculation by Sinorhizobium meliloti 1021
| PRJNA232307 | ENA
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress