Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

An RNA-recognition motif protein from Helicobacter pylori binds single-stranded RNAs and stabilizes a pathogenicity island-encoded small RNA

ABSTRACT: An RNA-recognition motif protein from Helicobacter pylori binds single-stranded RNAs and stabilizes a pathogenicity island-encoded small RNA

PROVIDER: PRJNA269182 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR1692400.fastq.gz	Fastqsanger.gz
	SRR1692401.fastq.gz	Fastqsanger.gz
	SRR1692402.fastq.gz	Fastqsanger.gz
	SRR1692393.fastq.gz	Fastqsanger.gz
	SRR1692394.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 10

Similar Datasets

An RNA-recognition motif protein from Helicobacter pylori binds single-stranded RNAs and stabilizes a pathogenicity island-encoded small RNA

Project description:This SuperSeries is composed of the SubSeries listed below.

2020-11-25 | GSE63834 | GEO

An RNA-recognition motif protein from Helicobacter pylori binds single-stranded RNAs and stabilizes a pathogenicity island-encoded small RNA (RIP-seq)

Project description:In this study several putative targets of the RRM protein RbpH (HP0827/HPG27_786) were identified. RNA binding targets of RbpH in two strains of H. pylori (G27 and 26695) were identified using RIP-seq.

2020-11-25 | GSE63833 | GEO

An RNA-recognition motif protein from Helicobacter pylori binds single-stranded RNAs and stabilizes a pathogenicity island-encoded small RNA (RNA-seq)

Project description:In this study several putative targets of the RRM protein RbpH (HPG27_786) were identified. Potential targets of RbpH in H. pylori (G27) were identified using total RNA-seq.

2020-11-25 | GSE63832 | GEO

Identification of an artificial peptide motif that binds and stabilizes reduced human DJ-1.

Project description:Although the precise biochemical function of DJ-1 remains unclear, it has been found to exert cytoprotective activity against oxidative stress. Cys106 is central to this function since it has a distinctly low pK(a) rendering it extremely susceptible for oxidation. This characteristic, however, also poses a severe hindrance to obtain reduced DJ-1 for in vitro investigation. We have developed an approach to produce recombinant human DJ-1 in its reduced form as a bona fide basis for exploring the redox capacities of the protein. We solved the crystal structure of this DJ-1 at 1.56Å resolution, allowing us to capture Cys106 in the reduced state for the first time. The dimeric structure reveals one molecule of DJ-1 in its reduced state while the other exhibits the characteristics of a mono-oxygenated cysteine. Comparison with previous structures indicates the absence of redox dependent global conformational changes in DJ-1. The capture of reduced Cys106 is facilitated by stabilization within the putative active site achieved through a glutamate side chain. This side chain is provided by a crystallographic neighbor as part of a 'Leu-Glu' motif, which was added to the C-terminus of DJ-1. In the structure this motif binds DJ-1 in close proximity to Cys106 through extended hydrophilic and hydrophobic interactions depicting a distinct binding pocket, which can serve as a basis for compound development targeting DJ-1.

| S-EPMC3212413 | biostudies-literature

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

i-motif studies

Project description:i-motif studies

| PRJNA1044026 | ENA

Pioneer factor-nucleosome binding events during differentiation are motif-encoded

Project description:Though the in vitro structural and in vivo spatial characteristics of transcription factor (TF) binding are well defined, TF interactions with chromatin and other companion TFs during development are poorly understood. To analyze such interactions in vivo, we profiled several TFs across a time course of human embryonic stem cell differentiation via CUT&RUN epigenome profiling, and studied their interactions with nucleosomes and co-occurring TFs by Enhanced Chromatin Occupancy (EChO), a computational strategy for classifying TF binding characteristics across time and space. EChO shows that at different enhancer targets, the same TF can employ either direct DNA binding, or “pioneer” nucleosome binding to access them. Pioneer binding is correlated with local binding of other TFs and enhancer motif character, including degeneracy at key bases in the pioneer factor target motif. Our strategy reveals a dynamic exchange of TFs at enhancers across developmental time that is aided by pioneer nucleosome binding.

2019-06-25 | GSE128499 | GEO

Plasma DNA motif analysis

Project description:Plasma DNA motif analysis

| EGAS00001003409 | EGA

Pioneer factor-nucleosome binding events during differentiation are motif-encoded

Project description:Pioneer factor-nucleosome binding events during differentiation are motif-encoded

| PRJNA527856 | ENA

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO