Podocnemis lewyana
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA273652 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Podocnemis expansa (Arrau river turtle) Genome
| PRJNA177923 | ENA
Project description:Podocnemis expansa Genome sequencing and assembly
| PRJNA512135 | ENA
Project description:Whole-genome sequencing is an important way to understand the genetic information, gene function, biological characteristics, and living mechanisms of organisms. There is no difficulty to have mega-level genomes sequenced at present. However, we encountered a hard-to-sequence genome of Pseudomonas aeruginosa phage PaP1. The shotgun sequencing method failed to dissect this genome. After insisting for 10 years and going over 3 generations of sequencing techniques, we successfully dissected the PaP1 genome with 91,715 bp in length. Single-molecule sequencing revealed that this genome contains lots of modified bases, including 51 N6-methyladenines (m6A) and 152 N4-methylcytosines (m4C). At the same time, further investigations revealed a novel immune mechanism of bacteria, by which the host bacteria can recognize and repel the modified bases containing inserts in large scale, and this led to the failure of the shotgun method in PaP1 genome sequencing. Strategy of resolving this problem is use of non-library dependent sequencing techniques or use of the nfi- mutant of E. coli DH5M-NM-1 as the host bacteria to construct the shotgun library. In conclusion, we unlock the mystery of phage PaP1 genome hard to be sequenced, and discover a new mechanism of bacterial immunity in present study. Methylation profiling of Pseudomonas aeruginosa phage PaP1 using kinetic data generated by single-molecule, real-time (SMRT) sequencing on the PacBio RS.
2013-08-22 | E-GEOD-50100 | biostudies-arrayexpress
Project description:Whole-genome sequencing is an important way to understand the genetic information, gene function, biological characteristics, and living mechanisms of organisms. There is no difficulty to have mega-level genomes sequenced at present. However, we encountered a hard-to-sequence genome of Pseudomonas aeruginosa phage PaP1. The shotgun sequencing method failed to dissect this genome. After insisting for 10 years and going over 3 generations of sequencing techniques, we successfully dissected the PaP1 genome with 91,715 bp in length. Single-molecule sequencing revealed that this genome contains lots of modified bases, including 51 N6-methyladenines (m6A) and 152 N4-methylcytosines (m4C). At the same time, further investigations revealed a novel immune mechanism of bacteria, by which the host bacteria can recognize and repel the modified bases containing inserts in large scale, and this led to the failure of the shotgun method in PaP1 genome sequencing. Strategy of resolving this problem is use of non-library dependent sequencing techniques or use of the nfi- mutant of E. coli DH5α as the host bacteria to construct the shotgun library. In conclusion, we unlock the mystery of phage PaP1 genome hard to be sequenced, and discover a new mechanism of bacterial immunity in present study.
2013-08-22 | GSE50100 | GEO
Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)
2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress
Project description:BackgroundCytogenetic studies were conducted in the Brazilian Amazon turtles, Podocnemis expansa Schweigger, 1912 (PEX) and Podocnemis unifilis Troschel, 1848 (PUN) to understand their karyoevolution. Their chromosomal complements were compared using banding techniques (C, G-, Ag-NOR and Chromomycin A3) and fluorescence in situ hybridization (FISH), and efforts were made to establish evolutionary chromosomal relationships within the Podocnemidae family.ResultsOur results revealed that both species have a chromosome complement of 2n = 28. For PEX and PUN, the fundamental numbers (FNs) were 54 and 52, respectively and the karyotypic formulas (KFs) were 24 m/sm + 2st + 2a and 22 m/sm + 2st + 4a, respectively. G-banding evidenced homologies between the two species and allowed identify a heteromorphic pair (chromosome pair 10) in PUN. In PEX, constitutive heterochromatin (CH) was found in the centromeric regions of pairs 1, 2, 4, 6 and 11 and on 9p. In PUN, CH was observed in the centromeric regions of all chromosomes, and in small proximal bands on 1p, 2p, 3q, 4q, 5q, 9q, 10q and 11q. Moreover, CH amplification was seen in one of the homologs of pair 10 (the heteromorphic pair). The CMA3 staining results were consistent with the CH findings. Ag-NOR staining showed that nucleolar organizing regions (NORs) were localized in the pericentromeric region of pair 1 in both species, and this result was confirmed by the 18S rDNA FISH probe. FISH with telomeric probes identified telomeric sequences in the distal regions of all chromosomes. In addition, interstitial telomeric sequences (ITSs) were present in seven chromosome pairs of PUN, perhaps reflecting the amplification of telomere-like sequences. FISH with a probe against the transposable element (TE), Rex 6, revealed that it is dispersed in euchromatic regions of the first chromosome pairs of both species. This is the first report describing the FISH-based analysis of PEX and PUN for the 18S rDNA, Rex 6 and human telomeric sequences.ConclusionsOur results contribute to clarifying the chromosomal homologies and rearrangement mechanisms that occurred during the evolution of these species, and may help researchers uncover new markers that will improve our understanding of the taxonomy and systematic classification of Podocnemidae.Trial registrationISRCTN ISRCTN73824458. Registered 28 September 2014. Retrospectively registered.
| S-EPMC5039792 | biostudies-literature
Project description:The draft genome of L. sativa (lettuce) cv. Tizian was sequenced in two Illumina sequencing runs, mate pair and shotgun. This entry contains the RAW sequencing data.
2018-02-09 | E-MTAB-6347 | biostudies-arrayexpress