Arabidopsis thaliana
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA294285 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR2219510.fastq.gz | Fastqsanger.gz | |||
| SRR2219511.fastq.gz | Fastqsanger.gz | |||
| SRR2219512.fastq.gz | Fastqsanger.gz | |||
| SRR2219513.fastq.gz | Fastqsanger.gz | |||
| SRR2219514.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 10 |
Similar Datasets
Project description:Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0
| PRJNA203678 | ENA
Project description:We were interested in identifying targets of novel putative miRNAs we identified from small RNA sequencing libraries of Arabidopsis shoots. The small RNA (smRNA) sequencing libraries were made to identify changes in abundance of specific smRNAs in response to developmental transitions in Arabidopsis thaliana shoots, with special focus on vegetative phase change. We specifically wanted to separate the temporal changes in gene expression that result from vegetative phase change and those from flowering. Because of the close timing between the juvenile-to-adult and adult-to-reproductive developmental transitions in Arabidopsis grown under long day conditions, we used the late-flowering genotype FRI;FLC developed by the lab of Richard Amasino by introgressing the FRI allele from Sf-2 into the Col-0 genetic background, which is fri;FLC. For the early flowering genotype, we used FRI;flc-3, also developed by the Amasino lab by EMS-mutagenizing FRI;FLC, identifying early flowering mutants, and backcrossing multiple times to eliminate other EMS-induced mutations. The onset of vegetative phase change in FRI;FLC and FRI;flc-3 under our growth conditions was identical, but the progression was slower in FRI;FLC. By sequencing small RNAs from shoot apices at different time points and fully-expanded leaves at different positions on the shoot and comparing the results between the two genotypes, we were able to obtain a clear picture of changes in small RNA abundance in response to vegetative phase change and flowering in Arabidopsis. We then used the remaining RNA to make genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0 libraries of a subset of our samples. GMUCT 2.0 allows you to identify RNAs that are 1) uncapped and in the process of 5’->3’ exonuclease degradation and 2) miRNA and siRNA-mediated cleavage products. We wanted to use these GMUCT 2.0 libraries to identify targets of novel putative miRNAs discovered by our smRNA sequencing, thereby supporting the idea that these novel putative miRNAs are in fact functional.
2016-02-01 | GSE72505 | GEO
Project description:To gain insight into the functional role of DNE1 in cytoplasmic mRNA decay, we performed Parallel Analysis of RNA Ends (PARE) and Global Mapping of Uncapped and Cleaved Transcripts (GMUCT) analysis to identify DNE1-dependent cleavage sites based on their sensitivity to XRN4 within the Arabidopsis transcriptome
2023-04-25 | GSE193247 | GEO
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:GMUCT 2.0 data were analyzed to globally identify 5’ ends differentially accumulated in SKI3 RNAi roots as compared with GUS RNAi, as well as those that change in abundance in response to rhizobia SUPERKILLER3 (*SKI3),* a member of SKI complex that guides RNAs to the 3 to 5' exoribonuclease of the exosome complex. In the absence of a functional SKI complex to thread transcripts to the exosome, the bulk of the mRNAs that accumulate in the cytoplasm are diverted to the 5 -to-3 XRN4 pathway for degradation. We explored the function of *SKI3* during root nodule symbiosis using RNA interference to knockdown *SKI3* in *M. truncatula* hairy roots. To evaluate whether silencing of *SKI3* in *M. truncatula* roots altered RNA decay in response to rhizobia, we performed genome-wide mapping of uncapped and cleaved transcripts (GMUCT 2.0) on *GUS* RNA and *SKI3*RNAi roots. This method identifies products of miRNA or siRNA guided-endonucleolytic cleavage as well as decapped mRNAs by selecting for molecules with a free 5 monophosphate (5 P) (Willmann et al., 2014). GMUCT 2.0 data were analyzed to globally identify 5' ends differentially accumulated in *SKI3* RNAi roots as compared with *GUS* RNAi, as well as those that change in abundance in response to rhizobia.
2022-10-01 | GSE135920 | GEO
Project description:Genome-wide mapping of uncapped and cleaved transcripts (GMUCT) and transcriptome of DCLs
| PRJNA292107 | ENA
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE.
2014-03-08 | GSE47121 | GEO
Project description:In order to gain insight into relative stability of transcripts in plants that lacked m6A, we performed global mapping of uncapped and cleaved transcripts
2018-11-09 | GSE108766 | GEO
Project description:Messenger RNA secondary structure is critical to all aspects of post-transcriptional regulation. However, the global regulatory and evolutionary significance of mRNA secondary structure remains largely illusive. Here, we describe a transcriptome-wide analysis of RNA secondary structure in humans and two non-human primates, based on a high-throughput, nuclease-mediated, structure mapping approach. Using this methodology, we uncover global patterns of mRNA secondary structure, which we find to be conserved through primate evolution. We provide evidence for secondary structure-based regulatory pathways, which impact on gene expression through associations with translational machinery and RNA-binding proteins, including components of the microprocessor complex. Our results lend support to an unexpected, conserved mechanism by which highly structured regions of mRNAs serve as processing sites for small RNAs, resulting in subsequent turnover. Global mRNA secondary structure analysis in primate transcriptomes using high-throughput, nuclease-mediated, structure mappinng approaches of dsRNA-seq and ssRNA-seq, also with polyA+ mRNA-seq, smRNA-seq (small RNA), and genome-wide mapping of uncapped and cleaved transcripts (GMUCT); these NGS-seq experiments were carried out in three primate brains as well as three different cell lines, both in in vitro and in vivo.
2017-05-01 | E-GEOD-57295 | biostudies-arrayexpress
Project description:Post-transcriptional chemical modification of RNA bases is a widespread and physiologically relevant regulator of RNA maturation, stability, and function. While modifications are best characterized in short, noncoding RNAs such as transfer RNAs (tRNAs), growing evidence indicates that messenger RNAs (mRNAs) and long noncoding RNAs (lncRNAs) are likewise modified. Here, we apply our High-throughput Annotation of Modified Ribonucleotides (HAMR) pipeline to identify and classify modifications that affect Watson-Crick base-pairing at three different levels of the human and Arabidopsis thaliana transcriptomes (polyadenylated, small, and degrading RNAs). We find modifications primarily within actively degrading mRNAs and lncRNAs, suggesting they can act as a potent signal for RNA turnover. Additionally, modifications within stable mRNAs mark alternatively spliced introns, suggesting they regulate splicing. Furthermore, these modifications target mRNAs with coherent functions, including stress responses. Thus, our comprehensive analysis of RNA modification across multiple RNA classes yields new functional insights into these covalent RNA additions. polyA-selected RNA-seq, smRNA-seq, and polyA-selected global mapping of uncapped transcripts (GMUCT) in Arabidopsis thaliana; smRNA-seq in HEK293T and HeLa human cell lines.
2015-10-31 | E-GEOD-66224 | biostudies-arrayexpress