Ontology highlight
ABSTRACT:
PROVIDER: PRJNA420933 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR6344820_1.fastq.gz | Fastqsanger.gz | |||
| SRR6344820_2.fastq.gz | Fastqsanger.gz | |||
| SRR6344830_1.fastq.gz | Fastqsanger.gz | |||
| SRR6344830_2.fastq.gz | Fastqsanger.gz | |||
| SRR6344840_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 146 |
Similar Datasets
Project description:The targeting range of CRISPR-Cas9 base editors (BEs) is limited by their G/C-rich PAM sequences. To overcome this limitation, we developed a CRISPR/Cpf1-based BE by fusing the rat cytosine deaminase APOBEC1 to a catalytically inactive version of Lachnospiraceae bacterium Cpf1. The base editor recognizes a T-rich PAM sequence and converts C to T in human cells with low levels of indels, non-C-to-T substitutions and off-target editing.
2018-03-18 | GSE110136 | GEO
Project description:C-to-T base editing mediated by CRISPR/Cas9 base editors (BEs) needs a G/C-rich PAM and the editing fidelity is compromised by unwanted indels and non-C-to-T substitutions. We developed CRISPR/Cpf1-based BEs to recognize a T-rich PAM and induce efficient C-to-T editing with few indels and/or non-C-to-T substitutions. The requirement of editing fidelity in therapeutic-related trials necessitates the development of CRISPR/Cpf1-based BEs, which also facilitates base editing in A/T-rich regions.
2018-10-16 | GSE105002 | GEO
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Identifying putative transcription factor target genes by combining CRISPR/Cas9-based transcriptional activation with RNAseq in Drosophila S2R+ cells. This study focuses on the transcription factors Twist and Snail, singly and together. RNA from Drosophila cells following CRISPR/Cas9-based activation of Twist, Snail, or Twist and Snail together, compared with non-targeting sgRNA. Two biological replicates for each experiment
2015-08-10 | E-GEOD-71430 | biostudies-arrayexpress
Project description:The CRISPR-Cas9 system enables efficient sequence-specific mutagenesis for creating germline mutants of model organisms. Key constraints in vivo remain the expression and delivery of active Cas9-guideRNA ribonucleoprotein complexes (RNPs) with minimal toxicity, variable mutagenesis efficiencies depending on targeting sequence, and high mutation mosaicism. Here, we established in vitro-assembled, fluorescent Cas9-sgRNA RNPs in stabilizing salt solution to achieve maximal mutagenesis efficiency in zebrafish embryos. Sequence analysis of targeted loci in individual embryos reveals highly efficient bi-allelic mutagenesis that reaches saturation at several tested gene loci. Such virtually complete mutagenesis reveals preliminary loss-of-function phenotypes for candidate genes in somatic mutant embryos for subsequent generation of stable germline mutants. We further show efficient targeting of functional non-coding elements in gene-regulatory regions using saturating mutagenesis towards uncovering functional control elements in transgenic reporters and endogenous genes. Our results suggest that in vitro assembled, fluorescent Cas9-sgRNA RNPs provide a rapid reverse-genetics tool for direct and scalable loss-of-function studies beyond zebrafish applications.
2016-05-01 | E-MTAB-4143 | biostudies-arrayexpress
Project description:Human acute myeloid leukemia cell lines OCI-AML2 and OCI-AML3 were used in a CRISPR/Cas9-mediated approach to specifically target DDX3X’s gene sequences encoding the RNA binding domain of the helicase. DDX3X RNA binding domain is bipartite in the two halves of the helicase core. sgRNAs were designed to target both halves of the domain (named RNA binding domain A and B – RBDA and RBDB). We performed RNA-seq to observe the gene expression changes in both OCI-AML2 and OCI-AML3 cell lines following the not-combined CRISPR/Cas9 –mediated targeting of both regions of the DDX3X RNA binding domain. Control CRISPR/Cas9 performed with no sgRNA expressing vector (named “empty vector”) was performed in both cell lines. The latter condition was used as a control for gene expression changes analysis, for each cell line.
2019-11-23 | E-MTAB-6241 | biostudies-arrayexpress
Project description:In this project, we cultured rat hippocampal neurons in mechanically different environments and studied electrical maturation. We compared WT neurons with two different Piezo1 knockdown conditions. These two knockdown conditions were generated in two independent CRISPR-Cas9 KD assays. Each assay is based on four different CRISPR-Cas9 guides targeting the Piezo1 gene. RNA sequencing was used to analyse the pathway leading to the stiffness dependent maturation behaviour.
2024-07-10 | E-MTAB-13503 | biostudies-arrayexpress