Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

V4 Miseq from deammonificaiton reator

ABSTRACT: V4 Miseq from deammonificaiton reator Raw sequence reads

PROVIDER: PRJNA429700 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR6470896_1.fastq.gz	Fastqsanger.gz
	SRR6470896_2.fastq.gz	Fastqsanger.gz
	SRR6470897_1.fastq.gz	Fastqsanger.gz
	SRR6470897_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 4 of 4

Similar Datasets

V4 Miseq from deammonificaiton reator with decreasing ammonia concentrations

Project description:V4 Miseq from deammonificaiton reator with decreasing ammonia concentrations Raw sequence reads

| PRJNA430308 | ENA

Miseq raw data

Project description:Miseq raw data Raw sequence reads

| PRJNA769988 | ENA

soil Miseq raw data

Project description:soil Miseq raw data Raw sequence reads

| PRJNA539995 | ENA

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

mice feces Illumina Miseq paired-end reads

Project description:mice feces Illumina Miseq paired-end reads Raw sequence reads

| PRJNA1012556 | ENA

ccRNA identification by circularization and miSeq

Project description:Efforts to identify ccRNA by sequencing by gibson circularization after template-switching 5' RACE using a cRNA-end specific primer and subsequent sequencing by Illumina miSeq. Sequencing of wild-type A/WSN/1933 and a variant bearing the mutation T677A in the PB1 subunit.

2024-09-10 | GSE276698 | GEO

Sphingobium sp. V4 strain:V4

Project description:Sphingobium sp. V4 strain:V4 Genome sequencing

| PRJNA753255 | ENA

18S rDNA V4 region of environmental samples

Project description:18S rDNA V4 region of environmental samples Raw sequence reads

| PRJNA910243 | ENA

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

8-week WT or Ftsj1 KO mouse brain tRNA and tRF MiSeq

Project description:8-week brain total tRNA, total tRNA fragments (tRFs), and ribosome-contained tRNAs were sequenced using MiSeq.

2021-03-31 | GSE153757 | GEO