Ontology highlight
ABSTRACT:
PROVIDER: PRJNA483000 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR7607756.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 1 of 1 |
Similar Datasets
Project description:The targeting range of CRISPR-Cas9 base editors (BEs) is limited by their G/C-rich PAM sequences. To overcome this limitation, we developed a CRISPR/Cpf1-based BE by fusing the rat cytosine deaminase APOBEC1 to a catalytically inactive version of Lachnospiraceae bacterium Cpf1. The base editor recognizes a T-rich PAM sequence and converts C to T in human cells with low levels of indels, non-C-to-T substitutions and off-target editing.
2018-03-18 | GSE110136 | GEO
Project description:C-to-T base editing mediated by CRISPR/Cas9 base editors (BEs) needs a G/C-rich PAM and the editing fidelity is compromised by unwanted indels and non-C-to-T substitutions. We developed CRISPR/Cpf1-based BEs to recognize a T-rich PAM and induce efficient C-to-T editing with few indels and/or non-C-to-T substitutions. The requirement of editing fidelity in therapeutic-related trials necessitates the development of CRISPR/Cpf1-based BEs, which also facilitates base editing in A/T-rich regions.
2018-10-16 | GSE105002 | GEO
Project description:We report the PAMs of phylogenetically-diverse Cas12a nucleases using a cell-free TXTL-based PAM screen. By adding a 5N randomized PAM library and Cas12a-gRNA in vitro, recognized PAM sequences were cleaved, while non-recognized PAMs remained. By amplifying the non-cleaved DNA, we used next-generation sequencing to analyze the depletion of functional PAMs of these Cas12a nucleases.
2020-03-02 | GSE130377 | GEO
Project description:The type V-I CRISPR-Cas system is becoming increasingly attractive for its potential utility in gene editing. However, natural nucleases often exhibit low efficiency, limiting their application. Here, we utilized structure-guided rational design and combinatorial protein engineering to optimize an uncharacterized Cas12i nuclease, Cas12i3. Accordingly, we developed Cas-SF01, a Cas12i3 variant that exhibits significantly improved gene-editing activity in mammalian cells and plants. Cas-SF01 displays comparable or superior editing performance compared to SpCas9 or recently engineered Cas12 nucleases. Further analysis of PAM recognition showed that Cas-SF01 has an expanded PAM range and effectively recognizes NTTN and noncanonical NATN and TTVN PAMs. Additionally, we identified an amino acid substitution, D876R, that markedly reduced the off-target effect while maintaining high on-target activity, leading to the development of Cas-SF01HiFi (high-fidelity Cas-SF01). Finally, we demonstrated that Cas-SF01 has robust gene-editing activity in both the monocot plant rice and dicot plant pepper. Our results suggest that Cas-SF01 can serve as a robust gene-editing platform with high efficiency and specificity for future genome editing applications across different organisms.
2023-11-05 | GSE236755 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:RNA-guided nucleases (RGNs) based on CRISPR systems permit installing short and large edits within eukaryotic genomes. However, precise genome editing is often hindered due to nuclease off- target activities and the multiple-copy character of the vast majority of chromosomal sequences. Dual nicking RGNs and high-specificity RGNs both exhibit low off-target activities. Here, we report that high-specificity Cas9 nucleases are convertible into nicking Cas9D10A variants whose precision is superior to that of the commonly used Cas9D10A nickase. Dual nicking RGNs based on a selected group of these Cas9D10A variants can yield gene knockouts and gene knock-ins at frequencies similar to or higher than those achieved by their conventional counterparts. Moreover, high-specificity dual nicking RGNs are capable of distinguishing highly similar sequences by “tiptoeing” over pre-existing single base-pair polymorphisms. Finally, high-specificity RNA-guided nicking complexes generally preserve genomic integrity, as demonstrated by unbiased genome-wide high-throughput sequencing assays. Thus, in addition to substantially enlarging the Cas9 nickase toolkit, we demonstrate the feasibility in expanding the range and precision of genome editing procedures. The herein introduced tools and multi-tier high-specificity genome editing strategies might be particularly beneficial whenever predictability and/or safety of genetic manipulations are paramount.
2020-12-08 | GSE153471 | GEO