Project description:Our results show that compared to wild type, a deletion mutant of the cas3 gene, an essential nuclease part of the class 1 type I CRISPR-Cas system, increases the virulence of P gingivalis.
Project description:We generated a collection of 13 plasmids, with each plasmid containing a variant of a CRISPR protospacer targeted by spacer 8 of the E. coli CRISPR-I array. We transformed the plasmids as a pool into delta cas3 E. coli cells expressing all other cas genes constitutively. We then transformed these cells with either an empty vector or a plasmid expressing the Cas3 nuclease. DNA surrounding the protospacers was PCR-amplified and sequenced.
Project description:Bacteria encode diverse defense systems including restriction-modification and CRISPR-Cas that cleave nucleic acid to protect against phage infection. Bioinformatic analyses demonstrate many recently identified anti-phage defense operons are comprised of a nuclease and NTPase protein, suggesting additional nucleic acid targeting systems remain to be understood. Here we develop large-scale comparative cell biology and biochemical approaches to analyze 16 nuclease-NTPase systems and define molecular features that control anti-phage defense. Purification, biochemical characterization, and in vitro reconstitution of nucleic acid degradation demonstrates protein–protein complex formation is a shared feature of multi-gene nuclease-NTPase systems. We show that AbpAB, Hachiman, and PD-T4-8 system nucleases use highly degenerate recognition site preferences to enable broad nucleic acid degradation, and the Azaca system exhibits specific phage targeting through the recognition of modified phage genomic DNA. Our results uncover principles of anti-phage defense system function and highlight the mechanistic diversity of nuclease-NTPase systems in bacterial immunity.
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
Project description:Bacteria are constantly threatened by their viral predators (phages), which has resulted in the development of defense systems for bacterial survival. One family of defense systems found widely across bacteria are OLD (for overcoming lysogeny defect) family nucleases. Despite recent discoveries regarding Class 2 and 4 OLD family nucleases and how phages overcome them, Class 1 OLD family nucleases warrant further study as there has only been one anti-phage Class 1 OLD family nuclease described to date. Here, we identify the Vibrio cholerae-encoded Class 1 OLD family nuclease Vc OLD and describe its disruption of genome replication of the lytic vibriophage ICP1. Furthermore, we examine its in vitro activity, identifying Vc OLD as a DNA nickase. Finally, we identify the first direct inhibitor of a Class 1 OLD family nuclease, the ICP1-encoded Oad1. Our research further illuminates Class 1 OLD family nucleases’ role in phage defense and explores the dynamic arms race between V. cholerae and its predatory phage ICP1.
2025-09-15 | PXD058617 | Pride
Project description:Study of the CRISPR accessory nuclease Card1
Project description:SORSC1 gene editing by CRISPR-Cas9 nuclease in heterozygous HFF for UROS inactivation. Fluorescent positive cell sorting for UROS and large rearrangements confirmation in chromosome 10q.
Project description:ABRAXAS2 gene editing by CRISPR-Cas9 nuclease in heterozygous HFF for UROS inactivation. Fluorescent positive cell sorting for UROS and large rearrangements confirmation in chromosome 10q.
Project description:SORSC1 gene editing by CRISPR-Cas9 nuclease in heterozygous HFF for UROS inactivation. Fluorescent positive cell sorting for UROS and large rearrangements confirmation in chromosome 10q.