Ontology highlight
ABSTRACT:
PROVIDER: PRJNA526996 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR8989350_1.fastq.gz | Fastqsanger.gz | |||
| SRR8989344_1.fastq.gz | Fastqsanger.gz | |||
| SRR8989345_1.fastq.gz | Fastqsanger.gz | |||
| SRR8989346_1.fastq.gz | Fastqsanger.gz | |||
| SRR8989347_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 7 |
Similar Datasets
Project description:To identify aberrant splicing isoforms and potential neoantigens, we performed full-length cDNA sequencing of lung adenocarcinoma cell lines using a long-read sequencer MinION. We constructed a comprehensive catalog of aberrant splicing isoforms and detected isoform-specific peptides using proteome analysis.
2020-12-09 | PXD019915 | JPOST Repository
Project description:Here we describe CapTrap-Seq, an experimental workflow designed to address the problem of reduced transcript end detection by long-read RNA sequencing methods, especially at the 5' ends. We apply CapTrap-Seq to profile transcriptomes of the human heart and brain and we compared the obtained results with other library preparation approaches. CapTrap-Seq is a platform-agnostic method and here tested the method by using 3 different long-read sequencing platforms: MinION (ONT), Sequel (PacBaio) and Sequel II (PacBio).
2023-12-20 | E-MTAB-13063 | biostudies-arrayexpress
Project description:We used the nanopore Cas9 targeted sequencing (nCATS) strategy to specifically sequence 125 L1HS-containing loci in parallel and measure their DNA methylation levels using nanopore long-read sequencing. Each targeted locus is sequenced at high coverage (~45X) with unambiguously mapped reads spanning the entire L1 element, as well as its flanking sequences over several kilobases. The genome-wide profile of L1 methylation was also assessed by bs-ATLAS-seq in the same cell lines (E-MTAB-10895).
2023-09-22 | E-MTAB-12247 | biostudies-arrayexpress
Project description:Long-read RNA sequencing (RNA-seq) is a powerful technology for transcriptome analysis, but the relatively low throughput of current long-read sequencing platforms limits transcript coverage. We present TEQUILA-seq, a versatile, easy-to-implement, and low-cost method for targeted long-read RNA-seq. TEQUILA-seq can be broadly used for targeted sequencing of full-length transcripts in diverse biomedical research settings.
2023-06-06 | GSE213984 | GEO
Project description:Long-read transcriptome sequencing provides us with a convenient tool for thorough study of biological processes such as neuronal plasticity. In this study, we aimed to perform transcriptional profiling of rat hippocampal primary neuron cultures after stimulation with picrotoxin (PTX) to further understand molecular mechanisms of neuronal activation. To overcome limitations of short-read RNA-Seq approaches we performed a Oxford Nanopore Technologies (ONT)-based long-read sequencing and transcriptome assembly of rat primary hippocampal culture mRNA at three time points after the PTX activation (30 min; 1 h and 5 h). Overall, we found 23652 novel transcrits in comparison to reference annotations, out of which ~6k were entirely novel and mostly transposable element-derived loci. Analysis of differentially expressed genes (DEG) showed that a total of 3046 genes were differentially expressed, of which 2037 were upregulated and 1009 were downregulated at 30 min after the PTX application, with only 446 and 13 genes differentially expressed at 1 h and 5 h time points respectively. Most notably, multiple genes encoding ribosomal proteins, with high basal expression level, were downregulated after 30 min incubation with PTX; we suggest that this indicates redistribution of transcriptional resources towards activity-induced genes. Novel loci and isoforms, observed in this study, could help us further understand the functional mRNA repertoire in neuronal plasticity processes. Together with other NGS techniques, the result of differential gene expression analysis of sequencing data obtained using MinION platform might provide a simple method to optimize further study of neuronal plasticity.
2022-11-25 | GSE218694 | GEO
Project description:The genome of two isogenic lines from Aedes aegypti from Ile Royale, French Guiana, with a marked difference in resistance to deltamethrin was investigated in order to understand the genetic basis of this phenotypic difference. Genomic sequencing was performed both with Illumina short, paired reads and with Minion long reads.
2024-01-01 | E-MTAB-13310 | biostudies-arrayexpress
Project description:MinION plasmid deep long read sequencing for sequence verification
| PRJEB60161 | ENA
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress