Ontology highlight
ABSTRACT:
PROVIDER: PRJNA601142 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR10883726_1.fastq.gz | Fastqsanger.gz | |||
| SRR10883726_2.fastq.gz | Fastqsanger.gz | |||
| SRR10883727_1.fastq.gz | Fastqsanger.gz | |||
| SRR10883727_2.fastq.gz | Fastqsanger.gz | |||
| SRR10883728_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 78 |
Similar Datasets
Project description:The use of CRISPR/Cas proteins for the creation of multiplex genome-engineering represents an important avenue for crop improvement, and further improvements for creation of knock-in plant lines via CRISPR-based technologies may enable the high-throughput creation of designer alleles. To circumvent limitations of the commonly used CRISPR/Cas9 system for multiplex genome-engineering, we explored the use of Moraxella bovoculi 3 Cas12a (Mb3Cas12a) for multiplex genome-editing in Arabidopsis thaliana. We identified optimized promoter sequences for driving expression of single transcript multiplex crRNA arrays in A. thaliana, resulting in stable germline transmission of Mb3Cas12a-edited alleles at multiple target sites. By utilizing this system, we demonstrate single-transcript multiplexed genome-engineering using of up to 13 crRNA targets. We further show high target specificity of Mb3Cas12a-based genome-editing via whole-genome sequencing. Taken together, our method provides a simplified platform for efficient multiplex-genome-engineering in plant-based systems.
2021-09-15 | GSE162875 | GEO
Project description:Use DNase-seq to assess genome-wide chromation remodeling which occurred in CRISPR/Cas9 and TALE genome engineering systems Determining chromatin structural changes in transfected cells vs. the parent HEK293T cells
2015-05-28 | E-GEOD-67007 | biostudies-arrayexpress
Project description:CRISPR-Cas9 delivery by AAV holds promise for gene therapy but faces critical barriers due to its potential immunogenicity and limited payload capacity. Here, we demonstrate genome engineering in postnatal mice using AAV-split-Cas9, a multi-functional platform customizable for genome-editing, transcriptional regulation, and other previously impracticable AAV-CRISPR-Cas9 applications. We identify crucial parameters that impact efficacy and clinical translation of our platform, including viral biodistribution, editing efficiencies in various organs, antigenicity, immunological reactions, and physiological outcomes. These results reveal that AAV-CRISPR-Cas9 evokes host responses with distinct cellular and molecular signatures, but unlike alternative delivery methods, does not induce detectable cellular damage in vivo. Our study provides a foundation for developing effective genome therapeutics mRNA-Seq from muscles (9 samples; 3 mice x 3 conditions) and lymph nodes (9 samples; 3 mice x 3 conditions).
2016-07-29 | E-GEOD-84534 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The aim of the experiment is to assess the robustness of CRISPR-Cas9 based genetic engineering. Using RNA sequencing, we are able to quantify the abundance of transcripts corresponding to CRISPR-targets and thus the degree of nonsense mediated decay.
2019-08-22 | E-MTAB-7061 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Genome engineering using CRISPR/Cas9 technology enables simple, efficient and precise genomic modifications in human cells. Conventional immortalized cell lines can be easily edited or screened using genome-wide libraries with lentiviral transduction. However, cell types derived from the differentiation of induced Pluripotent Stem Cells (iPSC), which often represent more relevant, patient-derived models for human pathology, are much more difficult to engineer as CRISPR/Cas9 delivery to these differentiated cells can be inefficient and toxic. Here, we present an efficient, lentiviral transduction protocol for delivery of CRISPR/Cas9 to macrophages derived from human iPSC with efficiencies close to 100%. We demonstrate CRISPR/Cas9 knockouts for three non-essential proof-of-concept genes - HPRT1, PPIB and CDK4. We then scale the protocol and validate for a genome-wide pooled CRISPR/Cas9 loss-of-function screen. This methodology enables, for the first time, systematic exploration of macrophage involvement in immune responses, chronic inflammation, neurodegenerative diseases and cancer progression, using efficient genome editing techniques.
| EGAS00001005102 | EGA
Project description:Use DNase-seq to assess genome-wide chromation remodeling which occurred in CRISPR/Cas9 and TALE genome engineering systems
2015-05-28 | GSE67007 | GEO
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress