Ontology highlight
ABSTRACT:
PROVIDER: PRJNA612602 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR11311400_1.fastq.gz | Fastqsanger.gz | |||
| SRR11311400_2.fastq.gz | Fastqsanger.gz | |||
| SRR11311500_1.fastq.gz | Fastqsanger.gz | |||
| SRR11311500_2.fastq.gz | Fastqsanger.gz | |||
| SRR11311600_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 630 |
Similar Datasets
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage. ChIP-seq of HA-dCas9 loaded with 4 sgRNAs (Phc1-sg1, Phc1-sg2, Nanog-sg2, and Nanog-sg3) in mouse, and 2 sgRNAs in human (EMX1-sg1 and EMX1-sg3)
2014-04-20 | E-GEOD-54745 | biostudies-arrayexpress
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM).
2014-08-29 | GSE57650 | GEO
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage.
2014-04-20 | GSE54745 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:RNA-guided genome editing with the CRISPR-Cas9 system has great potential for basic and clinical research, but the determinants of targeting specificity and the extent of off-target cleavage remain insufficiently understood. Using chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq), we mapped genome-wide binding sites of catalytically inactive Cas9 (dCas9) in HEK293T cells, in combination with 12 different single guide RNAs (sgRNAs). The number of off-target sites bound by dCas9 varied from ~10 to >1,000 depending on the sgRNA. Analysis of off-target binding sites showed the importance of the PAM-proximal region of the sgRNA guiding sequence and that dCas9 binding sites are enriched in open chromatin regions. When targeted with catalytically active Cas9, some off-target binding sites had indels above background levels in a region around the ChIP-seq peak, but generally at lower rates than the on-target sites. Our results elucidate major determinants of Cas9 targeting, and we show that ChIP-seq allows unbiased detection of Cas9 binding sites genome-wide 1.sgRNA1-6 binding sites were identified with ChipSeq by using HA antibody (there are 2 replicates for sgRNA1-3, one sample for sgRNA4-6,one control without sgRNA) 2.PCR products which amplifies " off-target genomic sites" were deep sequenced in the presence of WT Cas9+sgRNA or WT Cas9 alone( unique adaptor was used for each sgRNA and mixed for multiplex run)
2014-05-18 | E-GEOD-55887 | biostudies-arrayexpress
Project description:Off-target (OT) analysis of different guide RNAs targeting PKLR gene. GUIDE-Seq analyses were done in HEK293 cells stably expressing Cas9 transfected with gRNA complexes, generated using Alt-R® CRISPR-Cas9 crRNA XT and Alt-R®CRISPR-Cas9 tracrRNA, and transfected with a dsODN tag
2021-04-13 | GSE171935 | GEO
Project description:Assess the on- and off-target effects of dox-inducible CRISPR/Cas9 and CRISPRi constructs in a human iPS cell line. Transcript quantification of 3 cell lines, each plus or minus doxycycline and with or without specific single guide RNAs (sgRNAs), with 2 biological replicates each.
2016-01-19 | E-GEOD-76980 | biostudies-arrayexpress