Ontology highlight
ABSTRACT:
PROVIDER: PRJNA633914 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:NFYC-AS1 is an overlapping antisense RNA transcribed head-to-head to NFYC sense gene, encoding for the subunit C of NF-Y transcription factor, which is known as master regulator of cell cycle and proliferation in normal and tumor cells. Here we performed NFYC-AS1 silencing in lung squamous carcinoma H520 cells by Gapmer antisense oligonucleotides and CRISPR/Cas9 TSS deletion. Afterwards, we performed differentially expressed analysis and gene set enrichement analysis to investigate on NFYC-AS1 function and mechanism of action.
2024-03-08 | GSE240468 | GEO
Project description:The DNA methylome of 45 primary neuroblastoma tumors is profiled by enrichment with a methyl-CpG-binding domain (MBD) and massively parallel sequencing DNA of 45 primary tumors is sheared (fragments of ± 200 bp), followed by MBD-based (MethylCap kit of Diagenode) enrichement, library preparation and multiplexing. Both input DNA and captured DNA were sequenced paired-end on Illumina Hiseq2000
2015-11-19 | E-GEOD-69243 | biostudies-arrayexpress