Homo sapiens
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA670368 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR12994801_1.fastq.gz | Fastqsanger.gz | |||
| SRR12994801_2.fastq.gz | Fastqsanger.gz | |||
| SRR12994802_1.fastq.gz | Fastqsanger.gz | |||
| SRR12994802_2.fastq.gz | Fastqsanger.gz | |||
| SRR12994803_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 434 |
Similar Datasets
Project description:By a robust unbiased ChIP-seq approach, we demonstrated that CRISPR/Cas9 had crRNA-specific off-target binding activities in human genome. However, most of those binding off-targets could not be efficiently cleaved both in vivo and in vitro which suggested the cleavage off-target activity of CRISPR/Cas9 in human genome is very limited. We provided a valuable tool to further investigate the molecular mechanism of CRISPR/Cas9 and to optimize its in vivo targeting sgRNA binding sites were identified with ChipSeq by using GFP antibody (there are 2 replicates for egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in Hek293T cells, one egfa-t1 sgRNA,emx1 sgRNA and control without sgRNA in HeLaS3 cells)
2014-06-18 | E-GEOD-58511 | biostudies-arrayexpress
Project description:Kynureninase is a member of a large family of catalytically diverse but structurally homologous pyridoxal 5'-phosphate (PLP) dependent enzymes known as the aspartate aminotransferase superfamily or alpha-family. The Homo sapiens and other eukaryotic constitutive kynureninases preferentially catalyze the hydrolytic cleavage of 3-hydroxy-l-kynurenine to produce 3-hydroxyanthranilate and l-alanine, while l-kynurenine is the substrate of many prokaryotic inducible kynureninases. The human enzyme was cloned with an N-terminal hexahistidine tag, expressed, and purified from a bacterial expression system using Ni metal ion affinity chromatography. Kinetic characterization of the recombinant enzyme reveals classic Michaelis-Menten behavior, with a Km of 28.3 +/- 1.9 microM and a specific activity of 1.75 micromol min-1 mg-1 for 3-hydroxy-dl-kynurenine. Crystals of recombinant kynureninase that diffracted to 2.0 A were obtained, and the atomic structure of the PLP-bound holoenzyme was determined by molecular replacement using the Pseudomonas fluorescens kynureninase structure (PDB entry 1qz9) as the phasing model. A structural superposition with the P. fluorescens kynureninase revealed that these two structures resemble the "open" and "closed" conformations of aspartate aminotransferase. The comparison illustrates the dynamic nature of these proteins' small domains and reveals a role for Arg-434 similar to its role in other AAT alpha-family members. Docking of 3-hydroxy-l-kynurenine into the human kynureninase active site suggests that Asn-333 and His-102 are involved in substrate binding and molecular discrimination between inducible and constitutive kynureninase substrates.
| S-EPMC2531291 | biostudies-literature
Project description:RNA extracted at 240min. Samples are rRNA depleted. Expression measurement of Homo sapiens genes.
2019-07-31 | GSE114179 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:As the evolution of miRNA genes has been found to be one of the important factors in formation of the modern type of man, we performed a comparative analysis of the evolution of miRNA genes in two archaic hominines, Homo sapiens neanderthalensis and Homo sapiens denisova, and elucidated the expression of their target mRNAs in bain.A comparative analysis of the genomes of primates, including species in the genus Homo, identified a group of miRNA genes having fixed substitutions with important implications for the evolution of Homo sapiens neanderthalensis and Homo sapiens denisova. The mRNAs targeted by miRNAs with mutations specific for Homo sapiens denisova exhibited enhanced expression during postnatal brain development in modern humans. By contrast, the expression of mRNAs targeted by miRNAs bearing variations specific for Homo sapiens neanderthalensis was shown to be enhanced in prenatal brain development.Our results highlight the importance of changes in miRNA gene sequences in the course of Homo sapiens denisova and Homo sapiens neanderthalensis evolution. The genetic alterations of miRNAs regulating the spatiotemporal expression of multiple genes in the prenatal and postnatal brain may contribute to the progressive evolution of brain function, which is consistent with the observations of fine technical and typological properties of tools and decorative items reported from archaeological Denisovan sites. The data also suggest that differential spatial-temporal regulation of gene products promoted by the subspecies-specific mutations in the miRNA genes might have occurred in the brains of Homo sapiens denisova and Homo sapiens neanderthalensis, potentially contributing to the cultural differences between these two archaic hominines.
| S-EPMC4686780 | biostudies-literature
Project description:PurposeWe investigated the evidence of recent positive selection in the human phototransduction system at single nucleotide polymorphism (SNP) and gene level.MethodsSNP genotyping data from the International HapMap Project for European, Eastern Asian, and African populations was used to discover differences in haplotype length and allele frequency between these populations. Numeric selection metrics were computed for each SNP and aggregated into gene-level metrics to measure evidence of recent positive selection. The level of recent positive selection in phototransduction genes was evaluated and compared to a set of genes shown previously to be under recent selection, and a set of highly conserved genes as positive and negative controls, respectively.ResultsSix of 20 phototransduction genes evaluated had gene-level selection metrics above the 90th percentile: RGS9, GNB1, RHO, PDE6G, GNAT1, and SLC24A1. The selection signal across these genes was found to be of similar magnitude to the positive control genes and much greater than the negative control genes.ConclusionsThere is evidence for selective pressure in the genes involved in retinal phototransduction, and traces of this selective pressure can be demonstrated using SNP-level and gene-level metrics of allelic variation. We hypothesize that the selective pressure on these genes was related to their role in low light vision and retinal adaptation to ambient light changes. Uncovering the underlying genetics of evolutionary adaptations in phototransduction not only allows greater understanding of vision and visual diseases, but also the development of patient-specific diagnostic and intervention strategies.
| S-EPMC3743458 | biostudies-literature
Project description:Cortical thickness has been investigated since the beginning of the 20th century, but we do not know how similar the cortical thickness profiles among humans are. In this study, the local similarity of cortical thickness profiles was investigated using sliding window methods. Here, we show that approximately 5% of the cortical thickness profiles are similarly expressed among humans while 45% of the cortical thickness profiles show a high level of heterogeneity. Therefore, heterogeneity is the rule, not the exception. Cortical thickness profiles of somatosensory homunculi and the anterior insula are consistent among humans, while the cortical thickness profiles of the motor homunculus are more variable. Cortical thickness profiles of homunculi that code for muscle position and skin stimulation are highly similar among humans despite large differences in sex, education, and age. This finding suggests that the structure of these cortices remains well preserved over a lifetime. Our observations possibly relativize opinions on cortical plasticity.
| S-EPMC5738339 | biostudies-literature
Project description:Gene expression profiling of immortalized human mesenchymal stem cells with hTERT/E6/E7 transfected MSCs. hTERT may change gene expression in MSCs. Goal was to determine the gene expressions of immortalized MSCs.
2010-09-25 | GSE24338 | GEO
Project description:Ba/F3 cells were transformed after transfection with CRISPR/CAS9 + gRNA vs target gene. Oligoclonal cell population was flow sorted into single cells and processes for RNAseq.
2014-12-09 | E-ERAD-298 | biostudies-arrayexpress
Project description:Understanding the timing and character of the expansion of Homo sapiens out of Africa is critical for inferring the colonization and admixture processes that underpin global population history. It has been argued that dispersal out of Africa had an early phase, particularly ~130-90 thousand years ago (ka), that reached only the East Mediterranean Levant, and a later phase, ~60-50 ka, that extended across the diverse environments of Eurasia to Sahul. However, recent findings from East Asia and Sahul challenge this model. Here we show that H. sapiens was in the Arabian Peninsula before 85 ka. We describe the Al Wusta-1 (AW-1) intermediate phalanx from the site of Al Wusta in the Nefud desert, Saudi Arabia. AW-1 is the oldest directly dated fossil of our species outside Africa and the Levant. The palaeoenvironmental context of Al Wusta demonstrates that H. sapiens using Middle Palaeolithic stone tools dispersed into Arabia during a phase of increased precipitation driven by orbital forcing, in association with a primarily African fauna. A Bayesian model incorporating independent chronometric age estimates indicates a chronology for Al Wusta of ~95-86 ka, which we correlate with a humid episode in the later part of Marine Isotope Stage 5 known from various regional records. Al Wusta shows that early dispersals were more spatially and temporally extensive than previously thought. Early H. sapiens dispersals out of Africa were not limited to winter rainfall-fed Levantine Mediterranean woodlands immediately adjacent to Africa, but extended deep into the semi-arid grasslands of Arabia, facilitated by periods of enhanced monsoonal rainfall.
| S-EPMC5935238 | biostudies-literature