Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Flue-curing procedure

ABSTRACT: flue-curing procedure Raw sequence reads

PROVIDER: PRJNA685271 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13267400_1.fastq.gz	Fastqsanger.gz
	SRR13267400_2.fastq.gz	Fastqsanger.gz
	SRR13267401_1.fastq.gz	Fastqsanger.gz
	SRR13267401_2.fastq.gz	Fastqsanger.gz
	SRR13267402_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 176

Similar Datasets

Morus alba Raw protein sequence reads

Project description:Morus alba L. Raw protein sequence reads and sequence

2024-02-08 | PXD049451 |

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-05 | GSE121417 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-03 | GSE121413 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2021-08-11 | GSE175909 | GEO

Carbon-Nitrogen metabolic balance during curing of Flue-cured tobacco

Project description:Carbon-Nitrogen metabolic balance during curing of Flue-cured tobacco

| PRJEB75459 | ENA

Molecular Mechanism Study on the Contribution of Open-Fire Flue-curing Technology to Tobacco Leaf Aroma

Project description:Molecular Mechanism Study on the Contribution of Open-Fire Flue-curing Technology to Tobacco Leaf Aroma

2024-08-23 | PXD055097 |

Quantitative profiling of differentially expressed miRNAs in siCTL- and siOASL-transfected HUVECs

Project description:Purpose: The goal of this study is to compare endothelial small RNA transcriptome to identify the target of OASL under basal or stimulated conditions by utilizing miRNA-seq. Methods: Endothelial miRNA profilies of siCTL or siOASL transfected HUVECs were generated by illumina sequencing method, in duplicate. After sequencing, the raw sequence reads are filtered based on quality. The adapter sequences are also trimmed off the raw sequence reads. rRNA removed reads are sequentially aligned to reference genome (GRCh38) and miRNA prediction is performed by miRDeep2. Results: We identified known miRNA in species (miRDeep2) in the HUVECs transfected with siCTL or siOASL. The expression profile of mature miRNA is used to analyze differentially expressed miRNA(DE miRNA). Conclusions: Our study represents the first analysis of endothelial miRNA profiles affected by OASL knockdown with biologic replicates.

2022-09-06 | GSE186354 | GEO

Sequencing of siRNA from soybean containing silencing vectors and empty vectors

Project description:A cDNA library was constructed by Novogene (CA, USA) using a Small RNA Sample Pre Kit, and Illumina sequencing was conducted according to company workflow, using 20 million reads. Raw data were filtered for quality as determined by reads with a quality score > 5, reads containing N < 10%, no 5' primer contaminants, and reads with a 3' primer and insert tag. The 3' primer sequence was trimmed and reads with a poly A/T/G/C were removed

2021-07-21 | GSE180131 | GEO

Project description:Fungal diversity on tobacco leaves before and after flue-curing and redrying

| PRJNA975719 | ENA