Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [RNA-Seq]

ABSTRACT: LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [RNA-Seq]

PROVIDER: PRJNA688092 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR13311147.fastq.gz	Fastqsanger.gz
	SRR13311148.fastq.gz	Fastqsanger.gz
	SRR13311149.fastq.gz	Fastqsanger.gz
	SRR13311150.fastq.gz	Fastqsanger.gz
	SRR13311151.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [ChIP-Seq]

Project description:We explore the NF-κB responsive transcription that was regulated by Uc003xsl.1/NKRF complex. The chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) was performed for NKRF in MDA-MB-231-P3 cells treated with si-Uc003xsl.1 or control siRNA. The ChIP-seq data displayed 3604 peak calls in MDA-MB-231-P3 cells against control siRNA and were primarily identified as NF-κB targeting genes.

2021-11-29 | GSE163897 | GEO

LncRNA Uc003xsl.1 Activates NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF

Project description:LncRNA Uc003xsl.1 Activates NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF

| PRJNA688304 | ENA

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc231]

Project description:LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc231]

| PRJNA688093 | ENA

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc_p]

Project description:LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc_p]

| PRJNA688306 | ENA

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [ChIP-Seq]

Project description:LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [ChIP-Seq]

| PRJNA688088 | ENA

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [RNA-Seq]

Project description:The RNA-seq analysis was also performed on MDA-MB-231-P3 cells transfected with control or Uc003xsl.1 siRNA. A gene signature with highly significant expression changes post-Uc003xsl.1 siRNA treatment was observed

2021-11-29 | GSE163898 | GEO

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc_p]

Project description:To identify which of these lncRNAs were specifically involved in TNBC-related metastasis machinery, we also compared the lncRNA profiles of TNBC tumor tissues to that of luminal breast tumor tissues.Then, the lncRNAs, MIF-AS1, PRNCR1, and Uc003xsl.1, were also highly expressed in TNBCs in comparison to those of luminal tumors and were selected for further exploration.

2021-11-29 | GSE163951 | GEO

LncRNA Uc003xsl.1 Activates NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF

Project description:This SuperSeries is composed of the SubSeries listed below.

2021-11-29 | GSE163953 | GEO

LncRNA Uc003xsl.1 Activates of NF-κB/IL8 Axis to Promotes Triple-negative Breast Cancer Progression via A Decoy Role to NKRF [lnc231]

Project description:To discover the potential drivers of TNBC metastasis, we established an in vivo model by injecting MDA-MB-231cells into the tail veins of mice. Then, the breast tumor cells that successfully grew into metastatic lung tumors were collected and expanded in vitro, followed by re-injected into the tail veins of mice for lung metastasis. After three rounds of selection, a highly metastatic subline, MDA-MB-231-P3, was established, and more frequent micro-metastasis was detected in MDA-MB-231-P3 groups than that of MDA-MB-231 groups when the lungs of mice were stained with hematoxylin and eosin (HE). The lncRNA profiles of MDA-MB-231 or MDA-MB-231-P3 cells were analyzed by lncRNA sequencing. A total of 267 lncRNAs in MDA-MB-231-P3 cells were upregulated more than 2-fold in comparison to the MDA-MB-231 cells.

2021-11-29 | GSE163900 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data