Mosquitoes
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA723282 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR14288194_1.fastq.gz | Fastqsanger.gz | |||
| SRR14288194_2.fastq.gz | Fastqsanger.gz | |||
| SRR14288195_1.fastq.gz | Fastqsanger.gz | |||
| SRR14288195_2.fastq.gz | Fastqsanger.gz | |||
| SRR14288196_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Wolbachia pipientis strain:mosquitoes | isolate:mosquitoes Genome sequencing
| PRJNA524640 | ENA
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Determination of miRNA profiles in most prominent mosquitoes will determine the potential targets for mosquito control Some of the most medically important viruses, such as dengue virus, West Nile virus, Zika virus, and yellow fever virus, are transmitted by mosquitoes. These aptly named arboviruses impose a tremendous cost to the health of populations around the world. As a result, much effort has gone into the study of the impact of these viruses in human infections. Comparatively less efforts, however, have been made to study the way these viruses interact with mosquitos themselves. It has long been held that these viruses are introduced into the midgut of mosquitoes upon ingestion of a blood meal before being transmitted within the saliva upon subsequent feeding. This sequence requires that the mosquito be able to defend itself from infection every step along the way-from ingesting bloodmeal to subsequent feeding. The main defense mechanisms employed by the mosquitoes to control viruses is RNA interference (RNAi). Modulation of this facet of the mosquito’s immune system would thereby suggest a practical strategy for vector control. This paper will provide an up to date overview of the mosquito’s immune system along with novel data describing miRNA profiles for Aedes aegypti and Culex quinquefasiatus in Grenada, West Indies.
2020-04-29 | GSE149518 | GEO
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:We report that the mosquito small RNA expression level in mosquitoes following a sugar meal
2022-05-01 | GSE180776 | GEO
Project description:We report the human small RNA expression levels in mosquitoes following a blood meal
2022-05-01 | GSE167346 | GEO
Project description:Aedes mosquitoes transmit pathogenic arthropod-borne (arbo) viruses, putting nearly half the world’s population at risk. Blocking virus replication in mosquitoes rather than in humans serves as a promising approach to prevent arbovirus transmission, which requires in-depth knowledge of mosquito immunity. By integrating multi-omics data, we identified that heat shock factor 1 (Hsf1) regulates eight small heat shock protein (sHsp) genes within one topological associated domain. This Hsf1-sHsp cascade acts as an early response against chikungunya virus (CHIKV) infection and shows pan-antiviral activity in three vector mosquitoes, Aedes aegypti, Aedes albopictus, and Anopheles gambiae. We then assessed the baseline expression of sHsp genes in different tissues of female Ae. aegypti using RNA-seq, and we observed a highly dynamic expression pattern of sHsp genes that varied dramatically across different tissues. Interestingly, sHsp genes were expressed at low levels in two main barrier tissues, the midgut and salivary glands, compared to other tissues such as the crop. Importantly, activation of Hsf1 led to a reduced CHIKV infection rate in adult Ae. aegypti mosquitoes, demonstrating Hsf1 as a promising target for the development of novel intervention strategies to limit arbovirus transmission by mosquitoes.
2024-01-01 | GSE225070 | GEO